ID: 1093146293

View in Genome Browser
Species Human (GRCh38)
Location 12:15570650-15570672
Sequence TTGGAAATGAATGAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 674
Summary {0: 1, 1: 1, 2: 3, 3: 62, 4: 607}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093146289_1093146293 10 Left 1093146289 12:15570617-15570639 CCAAATGCTATACTCAAAGAAAT 0: 1
1: 0
2: 2
3: 27
4: 302
Right 1093146293 12:15570650-15570672 TTGGAAATGAATGAGGAGGATGG 0: 1
1: 1
2: 3
3: 62
4: 607

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093146293 Original CRISPR TTGGAAATGAATGAGGAGGA TGG Intronic
900199182 1:1395687-1395709 TTGGGAAGGGATGAGGAGGTTGG - Intronic
901235327 1:7664559-7664581 CTGGAACTGCATGAGGTGGAGGG - Exonic
901418445 1:9133756-9133778 AAGGAAATGACTGAGGGGGAAGG - Intergenic
901972731 1:12920539-12920561 TGGGAAAGGAATGAGGATGCAGG + Intronic
902012449 1:13281223-13281245 TGGGAAAGGAATGAGGATGCAGG - Exonic
902075608 1:13782434-13782456 TTGGACCTGAAGGATGAGGAGGG - Exonic
902095416 1:13940167-13940189 TTCCAAAAGAATGAAGAGGAGGG - Intergenic
902202286 1:14842847-14842869 CTGGAATTGAAGGAGGAGAAGGG - Intronic
903864758 1:26389912-26389934 TAGGAGCAGAATGAGGAGGAAGG + Intergenic
903916957 1:26771721-26771743 ATGGTAATGAATGGGAAGGAGGG + Intronic
904145092 1:28384197-28384219 TTCCAAAAGAATGAAGAGGAGGG - Intronic
904262586 1:29298375-29298397 TTGGAAAAGAAGGAAGTGGAAGG - Intronic
904402628 1:30266861-30266883 TTAGAAATAAATAAGGAGGCTGG - Intergenic
904684784 1:32252102-32252124 TTGGAAGTGAAAGAGAATGATGG + Intronic
904913819 1:33955139-33955161 TTGGAAATGAGGCAGGAGAAAGG - Intronic
905274721 1:36809793-36809815 AAGGAACTGAATGAGGAAGATGG + Intronic
905484108 1:38283721-38283743 TTGGATATGAAGGAGGAGAGGGG - Intergenic
906103570 1:43278399-43278421 CGGGAAGGGAATGAGGAGGAAGG + Intergenic
906308073 1:44733740-44733762 GTGGAAATGATTTAGGAAGAAGG + Intergenic
906551031 1:46666668-46666690 TTGAAAAAGAATGGAGAGGAGGG - Intronic
906578988 1:46918898-46918920 TTCCAAATAATTGAGGAGGAGGG - Intergenic
906776239 1:48532112-48532134 TTAGAAAGGAATGAGGAGACTGG - Intergenic
906794203 1:48683869-48683891 TGGAGAATGAATGAGGAAGACGG + Intronic
906812228 1:48839635-48839657 TTGGTGATGAATTAGGAGGTTGG + Intronic
907061811 1:51434628-51434650 TTGGAAATGAATGGTGATGATGG + Intronic
907190741 1:52645928-52645950 TTGGAAAACAAAGAAGAGGAGGG + Intronic
907473446 1:54689615-54689637 TTGGGTTTGAAGGAGGAGGAGGG + Intronic
908460628 1:64345455-64345477 TGGGAAATGCATGAAGATGAGGG + Intergenic
908752672 1:67439597-67439619 TAGGAAGAGAATGAGGAGGCTGG - Intergenic
908848058 1:68344973-68344995 GTGGAGATGAATGAGGTAGAGGG + Intergenic
909026244 1:70485633-70485655 CTGCAAATGAATGAGCAGTATGG + Intergenic
909421781 1:75475305-75475327 AAGGAAAGGAATGATGAGGAAGG + Intronic
909848207 1:80424983-80425005 TTAGAAATGAATAAAGTGGAAGG + Intergenic
910109338 1:83665990-83666012 TTGGAAATGATTGCAAAGGAAGG - Intergenic
910852200 1:91659527-91659549 TGGGAAATGGATAAGGAAGAAGG - Intergenic
911180031 1:94852283-94852305 TAGGAAATGCATGAGGGGGCAGG + Intronic
911843497 1:102716800-102716822 TTGGAAATGAATGAGTGAGGAGG - Intergenic
911936581 1:103983039-103983061 TTAGATATGAATGTGGAGGAAGG + Intergenic
912562568 1:110561113-110561135 TTGAAAATGAATCATGAGGGTGG - Intergenic
912927178 1:113923600-113923622 TTAGAAATGATTATGGAGGAAGG + Intergenic
913332699 1:117680471-117680493 AAGGGAATGAATGAGCAGGAAGG - Intergenic
913380005 1:118200124-118200146 TACGAAAAGCATGAGGAGGAAGG + Intergenic
913412021 1:118562601-118562623 TTGGATATGAATAAGGGGGAGGG + Intergenic
915072426 1:153281617-153281639 TTGGATGTGGATGAAGAGGAAGG + Intergenic
915138356 1:153750002-153750024 TTGGAAGGGAGTGAGAAGGAGGG - Intronic
915608449 1:156970403-156970425 TTGGAGATCTTTGAGGAGGATGG + Intronic
915940325 1:160114710-160114732 TTGGAAATGTCTGAGGAGTGAGG - Intergenic
916047075 1:161007943-161007965 TATGAAATAGATGAGGAGGATGG - Intronic
916394639 1:164372254-164372276 ATAGGAATGAATGAGGGGGAGGG + Intergenic
916498357 1:165365414-165365436 CTGGAGTTGAGTGAGGAGGAGGG - Intergenic
916593907 1:166223568-166223590 TTCCAAAAGATTGAGGAGGAGGG - Intergenic
917713246 1:177708845-177708867 TTTTAAATGATTGAGAAGGAAGG + Intergenic
917840003 1:178969840-178969862 CTGGAAATGAATGCTGAGCATGG + Intergenic
918477265 1:184938261-184938283 ATGGAAATGAATAAGAAAGAAGG + Intronic
918577114 1:186075438-186075460 TTGGAATTGAATGATGATTATGG + Intronic
918952410 1:191155938-191155960 TAAAAAATTAATGAGGAGGACGG - Intergenic
919059755 1:192617207-192617229 TTGTAAATGAATGGGAAAGAAGG - Intergenic
919677395 1:200397322-200397344 TTGGAAATGAATGACGTTCAGGG - Intergenic
919969566 1:202565528-202565550 CTGGAATTGCATGAGCAGGAGGG + Intronic
921621701 1:217332687-217332709 TTGGAAATGAAACAGGCTGAGGG + Intergenic
921969339 1:221129203-221129225 ATGGGAAGGAAGGAGGAGGAGGG + Intergenic
922454562 1:225764247-225764269 ATGGAAGTGAGTGAGGGGGATGG - Intergenic
923548853 1:234945397-234945419 GTGGAAAAGAATGAGTAGGCAGG + Intergenic
924341865 1:243043964-243043986 TTGGAAGTCAATCAGGAAGAGGG + Intergenic
1063251023 10:4274983-4275005 TGGGAACTGAATGATGAGAATGG + Intergenic
1064462767 10:15551029-15551051 TTGGAGAAGAATGGGGTGGATGG + Intronic
1064652284 10:17521677-17521699 TTGGATATGAATGAGGGAGAAGG - Intergenic
1065067359 10:21983836-21983858 TTAGAAATGAATAATGAAGATGG + Intronic
1065469631 10:26064368-26064390 TTGGAAAGAATTGAGTAGGAGGG + Intronic
1065499991 10:26370729-26370751 TTCCAAAAAAATGAGGAGGAGGG - Intergenic
1065662723 10:28022342-28022364 TTTGAAATGAATGTGGGGCATGG + Intergenic
1065672311 10:28133370-28133392 TTCAAGTTGAATGAGGAGGAGGG - Intronic
1066150707 10:32613613-32613635 TTGGAAACAAATGAGAAGAAAGG - Intronic
1066415080 10:35214266-35214288 AGGGAAAAGAATGAGGAGGAAGG - Intergenic
1066568963 10:36751084-36751106 ATGGAAATGAAAGAGGTGTATGG + Intergenic
1066786994 10:39015580-39015602 TGGGAACTCAATGAGGAGTATGG - Intergenic
1066800752 10:39186664-39186686 TTGGAACTCAATGAGGAAAATGG - Intergenic
1067005796 10:42660648-42660670 GTGGCAATGAGTGAGGAGGCTGG + Intergenic
1067571159 10:47372175-47372197 TTGGAAATGACTGGAGAGTAGGG + Intronic
1067946357 10:50691810-50691832 GTGGAAATGCATGAGGACGTGGG + Intergenic
1067976486 10:51031527-51031549 ATGGGAAAGAATGAGGAAGAAGG + Intronic
1068273498 10:54760818-54760840 ATGGAAATGGCTGAGGAGTATGG + Intronic
1068726574 10:60309617-60309639 CTGGAGATGAATAAGGAGGTTGG + Intronic
1069181024 10:65358591-65358613 TTGAAAGTAAATGAGGAGGTGGG + Intergenic
1069265692 10:66454770-66454792 ATGAAGATGAAGGAGGAGGAAGG + Intronic
1069612226 10:69781922-69781944 ATGGAAATGAATGAGGTGGGAGG + Intergenic
1069723721 10:70564751-70564773 GAACAAATGAATGAGGAGGAGGG + Intronic
1069851385 10:71407436-71407458 ATGGGAGTGAATGAGGTGGATGG + Intronic
1070544642 10:77442777-77442799 TTGGGTGTGAAGGAGGAGGAGGG - Intronic
1070656241 10:78273507-78273529 TTGGGAGTTGATGAGGAGGAGGG - Intergenic
1071344755 10:84682368-84682390 TTGGAAATGAAAGACAAGTATGG - Intergenic
1071945864 10:90644381-90644403 TTAGGAATGAATCAAGAGGAAGG + Intergenic
1072842565 10:98791211-98791233 CTGGAATTGACTGAGGGGGAGGG + Intronic
1073083628 10:100874862-100874884 GCAGACATGAATGAGGAGGAAGG + Intergenic
1073732042 10:106300513-106300535 TTGCAAAGGAATGAGAATGATGG - Intergenic
1074802714 10:117017595-117017617 TAGAAAATTAATGAGGAAGAAGG + Intronic
1075337208 10:121617153-121617175 TTGGAAAAGGAGAAGGAGGAAGG + Intergenic
1076163993 10:128267783-128267805 GAGGAAAGGAAGGAGGAGGAAGG - Intergenic
1076323613 10:129602736-129602758 CTGGAAAGGAAGGAGGGGGAGGG - Intronic
1076397013 10:130146617-130146639 TTAGAAATGAATTATCAGGAGGG + Intronic
1076419869 10:130323756-130323778 TTGCAAATGTATGACAAGGATGG - Intergenic
1077143727 11:1035809-1035831 TTGGAGAGGAAGGAGGAGCACGG + Intronic
1077427261 11:2488407-2488429 TTGGGAAAGATTGAGAAGGATGG + Intronic
1077701616 11:4447310-4447332 TTGGATATAAAGGATGAGGAAGG + Intergenic
1078373729 11:10774866-10774888 TTGGGAAAGAAGGAAGAGGAAGG + Intronic
1078423900 11:11234031-11234053 TTGGAAATGAATGCGAAGGAGGG - Intergenic
1078588940 11:12621000-12621022 AAGGAAATGAAAGAGGAAGAAGG + Intergenic
1078619054 11:12891161-12891183 TAGGATAGGAATGAGAAGGAAGG - Intronic
1078781357 11:14442098-14442120 ATGGAAATGAATGAGTGGAATGG + Intergenic
1078816408 11:14826774-14826796 TTACAAAAAAATGAGGAGGAAGG + Intronic
1078850966 11:15163320-15163342 AGGGAAAAGAATGAGAAGGAAGG - Intronic
1079905246 11:26237022-26237044 TTGGAATTGTAGGAGAAGGAGGG - Intergenic
1079944843 11:26729237-26729259 GTGGAAAAGAAGGATGAGGAAGG - Intergenic
1080282542 11:30574879-30574901 TTGGAACTGAATTTGCAGGAGGG - Intronic
1080384770 11:31804814-31804836 TTTGAAATGAGTGAGGAGGGAGG - Intronic
1081051334 11:38345195-38345217 TTGGAAATGAGGAAGGAGCAAGG - Intergenic
1081083639 11:38773396-38773418 TTTTAAATAATTGAGGAGGAAGG + Intergenic
1081557430 11:44178383-44178405 GAGGAAATGGATGAGGAGAAAGG - Intronic
1081867234 11:46366596-46366618 GTGGGCATGAATGAGGAGGAGGG + Exonic
1082079445 11:48000741-48000763 GAGGAAATGAAGGAGGATGATGG - Intronic
1084694288 11:70744537-70744559 TTGGAAAGGAGCAAGGAGGAGGG - Intronic
1085491802 11:76926714-76926736 TTAGAAATGAATGAGAAAAATGG - Intronic
1085933649 11:81117835-81117857 TTGGAAATGAAATATGGGGAAGG - Intergenic
1087207925 11:95416856-95416878 TTGGGAATGATGGTGGAGGAAGG - Intergenic
1088232362 11:107686196-107686218 TGAGGAATGAATGAAGAGGAAGG + Intergenic
1088234031 11:107703508-107703530 TTGGAAATGAGAGTGGAGGTAGG + Intergenic
1088297890 11:108320756-108320778 TTTCAAATGTGTGAGGAGGAGGG - Intronic
1088446939 11:109941020-109941042 TTTGAAAACAAGGAGGAGGAAGG + Intergenic
1089084606 11:115806392-115806414 TTGGAAATAAATAAAGATGAAGG + Intergenic
1089182976 11:116595637-116595659 TGGGAAATCAATAAGGAGGCGGG + Intergenic
1089304838 11:117520051-117520073 GTGGCAATGAAGGAGGAGGTGGG + Intronic
1089458988 11:118641746-118641768 ATGGAAGCGAACGAGGAGGAGGG - Intronic
1089870926 11:121672045-121672067 TAGGACATGAATGAAGAAGAGGG - Intergenic
1090663388 11:128898094-128898116 TTGGAAAAGAATAAAGTGGAAGG - Intronic
1090717923 11:129446702-129446724 TTGGAGATGACTGGGGAGCAGGG - Intronic
1090797336 11:130146409-130146431 GTGGAAATGAATGAGAGGCAGGG + Intergenic
1091413506 12:259970-259992 ATGGAAAAGAAGGAGGAAGATGG - Exonic
1091736505 12:2926588-2926610 CTTGAAATGGATGAGGAGTATGG - Intronic
1091938664 12:4454562-4454584 TTGGAAAGGTCTCAGGAGGAAGG + Intergenic
1091965882 12:4741248-4741270 TTGGAAATAAAAAAAGAGGAAGG - Intronic
1092216628 12:6688534-6688556 TTAGAGATGGAGGAGGAGGAGGG + Intronic
1092573470 12:9751607-9751629 TTGGAAATGTATGATGTGTATGG - Intergenic
1092931479 12:13319912-13319934 ATGGAAAGAAAGGAGGAGGAAGG + Intergenic
1093114411 12:15191725-15191747 TTGGAATTGACTGAGGAGAGAGG - Intronic
1093146293 12:15570650-15570672 TTGGAAATGAATGAGGAGGATGG + Intronic
1093512588 12:19946739-19946761 TGGGGAAAGAATGATGAGGAAGG + Intergenic
1093637413 12:21488026-21488048 TTGGAAAAGAATGACTATGAAGG - Intronic
1093692982 12:22128211-22128233 TTGGAGATGAGTGAGGGGGTCGG - Intronic
1093808323 12:23463859-23463881 TTGGAGATGAATGGTGATGATGG + Intergenic
1094180861 12:27591310-27591332 CTGTGATTGAATGAGGAGGATGG + Intronic
1094661998 12:32478752-32478774 TTGGTAAGGTATGAGGAGGACGG - Intronic
1094794288 12:33952478-33952500 TTGAAAATGAGTAAGGAAGATGG - Intergenic
1095607641 12:44089176-44089198 TTTGAAATGAATGAAAAGGAAGG + Intronic
1095856711 12:46867618-46867640 TTTGAATAGAATGAGGAGGCAGG + Intergenic
1096848293 12:54419512-54419534 CTGGAAAGGAATGGGGAGGAAGG - Intergenic
1097698634 12:62798689-62798711 TGGCAGGTGAATGAGGAGGAAGG - Intronic
1097923052 12:65097699-65097721 TTAGAAATAAATGTTGAGGAAGG - Intronic
1098258377 12:68641308-68641330 TTTGAAATGAAAGTGGAAGAAGG - Intronic
1098354186 12:69595021-69595043 TTGAAAATGAATGAATAGGTTGG + Intronic
1098859821 12:75695721-75695743 TTGGAATTGAATGAAGGAGAGGG + Intergenic
1099165642 12:79304008-79304030 TTGTGAATGAATGACCAGGAAGG - Intronic
1099174580 12:79406055-79406077 ATGGAAATGAAAGAGGAGAAAGG + Intronic
1099293561 12:80802534-80802556 TTGGAAAATAATATGGAGGAGGG - Intronic
1100786925 12:98088568-98088590 TGGGTAGTGAATGAGGAGGTTGG - Intergenic
1101323493 12:103694371-103694393 TTGGAGCTGAAGGGGGAGGAGGG - Intronic
1102367266 12:112348981-112349003 TTGCCTTTGAATGAGGAGGAGGG + Intronic
1102435123 12:112916804-112916826 TTGGAAATGGAGGAGGTGGGAGG + Intronic
1103058891 12:117842982-117843004 TTGGGAAGGAGGGAGGAGGAAGG + Intronic
1104659244 12:130597927-130597949 TTGGAAAAGAAGGAGGAAAATGG + Intronic
1106330204 13:28732882-28732904 TAGGATATAGATGAGGAGGAGGG - Intergenic
1106354083 13:28962952-28962974 TTGGAAATGATAGAGTAGAAAGG - Intronic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1106621377 13:31374196-31374218 TGGGAAAAGAAGCAGGAGGAGGG - Intergenic
1107527364 13:41246387-41246409 TTAGAAATGCATTAGGAAGATGG - Intronic
1108546893 13:51503891-51503913 GAGGAAATGAAGGAGCAGGAAGG + Intergenic
1108577120 13:51800104-51800126 TAGGGAATAAAGGAGGAGGATGG + Intronic
1108974703 13:56424315-56424337 TTGGAAATGCAGGAGGAGCTGGG + Intergenic
1109714532 13:66204352-66204374 TTGGAGATGAATAAGGAAGTTGG - Intergenic
1109783547 13:67144257-67144279 TTTAAAATGAAAGAGGAAGAAGG + Intronic
1110050974 13:70898583-70898605 TTGGAAATGGTGGGGGAGGAGGG - Intergenic
1111620790 13:90722805-90722827 TTGGGAATGAGTGAGGAGAGAGG + Intergenic
1111938727 13:94585858-94585880 TTGGAAATTAAATAGGAAGAGGG + Intronic
1112495592 13:99901287-99901309 TTGGAATTGTAAGGGGAGGAAGG - Intergenic
1113094390 13:106648406-106648428 TTGAATATGAATGAGGACTAGGG + Intergenic
1113390742 13:109893955-109893977 CTGGAAAGCAATGAGCAGGAGGG + Intergenic
1114007286 14:18328756-18328778 TTGGAAGTGAAAGAGGGGTATGG + Intergenic
1115474839 14:33802905-33802927 TGGGGAAGGAATGAAGAGGAGGG - Intronic
1115627569 14:35209351-35209373 ATGGAAATTTATGAGGAGGAAGG - Intronic
1116160480 14:41261436-41261458 TTGGAGATGAATGTGTAGTAAGG + Intergenic
1116412432 14:44640835-44640857 TTGTATGTGAAGGAGGAGGAAGG + Intergenic
1117205314 14:53436614-53436636 TTGGAAATGAACAAGGAAGCTGG + Intergenic
1118780225 14:69003051-69003073 TTGGCCATGAAGGAGGAGGGAGG - Intergenic
1119370232 14:74134033-74134055 TTGGAAATGAAGGAGGTACACGG + Intronic
1119964809 14:78902532-78902554 AAGGAGATGAAGGAGGAGGAAGG + Intronic
1119989252 14:79176682-79176704 TTGAACATGAATGGGTAGGAGGG - Intronic
1120059337 14:79963773-79963795 TTGGATTTGGAGGAGGAGGAGGG - Intergenic
1120453541 14:84702226-84702248 TTGGAACAGAATGTTGAGGAAGG + Intergenic
1121951746 14:98176955-98176977 TAGAAAATGAATGAGGTGGGAGG - Intergenic
1123391204 15:19875416-19875438 TTGGAAGTGAAAGAGGGGTATGG + Intergenic
1124061232 15:26295274-26295296 TTGTAATTAAAGGAGGAGGAGGG - Intergenic
1124100397 15:26687580-26687602 TGAGAAATGATTGAGAAGGAAGG - Intronic
1124903101 15:33842712-33842734 TTGGAAAGGAATGAGGACTGAGG + Intronic
1125221885 15:37347280-37347302 ATGGACATGACTGAGGTGGAAGG + Intergenic
1125247971 15:37663610-37663632 TTTCAAAAAAATGAGGAGGAGGG - Intergenic
1125647115 15:41282188-41282210 CTGCACATGAATGAGGAGGTGGG - Intergenic
1126570526 15:50145925-50145947 ATGAAAATGAATGAGAAAGATGG + Intronic
1126740456 15:51771839-51771861 TGGGAAACAAATTAGGAGGATGG - Intronic
1127368635 15:58314525-58314547 TAGGAAATGAACGAGGAGAGAGG + Intronic
1127494170 15:59493882-59493904 TTAGAAAAGAAGGAGGAGGCCGG - Intronic
1128006889 15:64251060-64251082 TTGCAAATTAATGAGGACAATGG + Intronic
1128294868 15:66509874-66509896 TTAAAAATCAATGAGGAAGATGG + Intronic
1128404126 15:67317766-67317788 ATGTAATTGAATGAAGAGGAAGG + Intronic
1128942545 15:71800434-71800456 TTGGAGATCAGTGAGCAGGAAGG - Intronic
1129564925 15:76611534-76611556 TTGCAAAAAATTGAGGAGGAGGG + Intronic
1130959815 15:88652360-88652382 ATGGAGATGGGTGAGGAGGAGGG - Intronic
1131007125 15:88987323-88987345 AGGGAATTGAATGTGGAGGAGGG - Intergenic
1131621330 15:94071161-94071183 ATGGAAATAAATGAGGATGAAGG + Intergenic
1131636630 15:94239732-94239754 TTGGCAAAGAATGAGAAAGAAGG + Intronic
1132050770 15:98606070-98606092 GAATAAATGAATGAGGAGGAAGG - Intergenic
1132992724 16:2805356-2805378 CTGGACATGAGTGAAGAGGAGGG - Intergenic
1133110110 16:3542999-3543021 TTTGAAATGGAAGAGGAGGAAGG - Intronic
1133210856 16:4262738-4262760 CTGGAGATGAATGATGAAGAGGG - Intronic
1133292255 16:4730142-4730164 TCGGACATCACTGAGGAGGAAGG + Exonic
1133471577 16:6081071-6081093 TTTTAAATGAATGTGGAGCATGG + Intronic
1133957842 16:10461503-10461525 TTGCAAATGAATGAAAATGAAGG + Intronic
1134141348 16:11722292-11722314 GTGGAAATGAATGTGTAGGGTGG - Intronic
1134629878 16:15748915-15748937 TAGGAAGTGAATGAGGGGGCTGG - Intronic
1134771837 16:16815867-16815889 TTGGAAATCAATTAAGGGGAAGG - Intergenic
1135833658 16:25802527-25802549 TTGAAAAAGAATGACAAGGAAGG - Intronic
1135841001 16:25876106-25876128 TGGGAAATGAATGAAGAGACTGG - Intronic
1137004877 16:35266584-35266606 GTGGAAAAGAATGAGTAGAATGG - Intergenic
1137854061 16:51775818-51775840 TTGGAAGAGAAGGAGGAGGTGGG - Intergenic
1137913808 16:52406246-52406268 TTGGTAAAGAATGAGGCAGAGGG - Intergenic
1138659109 16:58507438-58507460 TTGTAGAAGAATGAGAAGGAGGG - Intronic
1139186894 16:64816943-64816965 TTTCAAATAATTGAGGAGGAGGG - Intergenic
1139280877 16:65769411-65769433 TTGAAACTGAGAGAGGAGGAAGG - Intergenic
1140155982 16:72427186-72427208 ATGGGAGTGAAGGAGGAGGAGGG + Intergenic
1140582548 16:76248685-76248707 TGGGAAGGGTATGAGGAGGAAGG + Intergenic
1140866914 16:79070552-79070574 TTGGCAATGAGTGAGGCAGACGG + Intronic
1141211711 16:81987130-81987152 CTGGAAATGAGGGAGGAAGATGG - Intergenic
1141845220 16:86603891-86603913 AAGGAAAGGAAGGAGGAGGAGGG - Intergenic
1142599589 17:1047144-1047166 TAGGAAAGGCAGGAGGAGGAGGG - Intronic
1142798078 17:2324666-2324688 GTGGGTATGAAGGAGGAGGATGG - Exonic
1142942732 17:3396343-3396365 GTGAAAATAAATCAGGAGGAGGG + Intergenic
1143622177 17:8087003-8087025 TTAGAGATGAAGGAGCAGGATGG + Intronic
1143849182 17:9796826-9796848 CTGGAATAGAGTGAGGAGGAAGG + Intronic
1143929386 17:10405734-10405756 TTGGAAATGATAGATGAGGTGGG + Intronic
1144051165 17:11498268-11498290 TTGGGGATGGAGGAGGAGGAAGG - Intronic
1144325937 17:14179931-14179953 TTTGAAATGAATGATGAAGATGG + Intronic
1144439351 17:15267324-15267346 TTGGAAATGGGAGACGAGGAAGG - Intergenic
1144474810 17:15576819-15576841 TTTGAAATGAATGATGAAGATGG + Intronic
1145704346 17:26858293-26858315 TTGGAAATGAATGGAATGGAAGG + Intergenic
1145821173 17:27836910-27836932 AAGGAAATGAAAGAGGAGGGTGG - Intronic
1146502785 17:33378673-33378695 TTGGAAATGAACTGGCAGGAAGG + Intronic
1147484756 17:40801861-40801883 ATGGAAGTGAAGAAGGAGGATGG + Intergenic
1147512525 17:41083718-41083740 TTGGAAAGGAATTAGAAGGAAGG - Intergenic
1147513988 17:41098555-41098577 TTGGGAAGGAATTAGAAGGAAGG + Intronic
1147514690 17:41104900-41104922 TTGGAAAGGAATTAGAAGGAAGG - Intronic
1147795885 17:43042462-43042484 CTGGAAAGGAAGGAGGAGAAAGG - Intergenic
1147890016 17:43710554-43710576 TTGGAAATGGCTGAGTAGGGTGG + Intergenic
1148249594 17:46064625-46064647 TTGGAGAGGGAGGAGGAGGAGGG - Intronic
1148853197 17:50564769-50564791 TTGGAAATTAAATTGGAGGAGGG - Intronic
1151269723 17:72984818-72984840 TGTTAAATGAATAAGGAGGAAGG + Intronic
1151335476 17:73437233-73437255 GCGGAAATGAATCAGAAGGAAGG + Intronic
1152328569 17:79657134-79657156 GAGGAGAAGAATGAGGAGGAAGG + Intergenic
1153014827 18:574070-574092 ATGGAAAAGTGTGAGGAGGAAGG - Intergenic
1153437267 18:5080943-5080965 TTAGAAATGAATGAGAATGAAGG + Intergenic
1153462160 18:5347806-5347828 TTCCAAAAAAATGAGGAGGAGGG + Intergenic
1154503150 18:15006321-15006343 TTGGAAGTGGATGGGGATGATGG - Intergenic
1155354574 18:24939951-24939973 CTGGAAAAGAATGAGGGAGATGG - Intergenic
1155384750 18:25265535-25265557 GTGAGAATGAATGAGGAGGATGG - Intronic
1155493009 18:26418222-26418244 TTAGCAATGATTGGGGAGGAAGG - Intergenic
1155615930 18:27721419-27721441 TTGGAAAGCAATGACGAGGGAGG - Intergenic
1155881094 18:31149847-31149869 TTGGAGAAAAATGAGTAGGAAGG - Intronic
1156232366 18:35165958-35165980 ATGGAAAAGAAAAAGGAGGATGG + Intergenic
1156278612 18:35610167-35610189 TTGGATGTGAATGAAGAGCAGGG + Intronic
1156435518 18:37124239-37124261 TTTGAAATGAGTGAGAAGAAAGG - Intronic
1156563208 18:38153064-38153086 TTCCAAATAATTGAGGAGGAGGG + Intergenic
1156856871 18:41792216-41792238 TTAGAAATTAATGAGGATAATGG - Intergenic
1156996744 18:43478380-43478402 TTGACAATGGATAAGGAGGAAGG - Intergenic
1157303667 18:46500101-46500123 ATGGAAAAGAAGGAAGAGGAGGG - Intronic
1157555044 18:48607979-48608001 TTGGAAATAAATCAGGACGAAGG - Intronic
1157729133 18:49988711-49988733 CTGGGAAGGAAAGAGGAGGATGG + Intronic
1158333604 18:56390356-56390378 CTGGCACTGAATGAGGATGAAGG - Intergenic
1158621853 18:59039871-59039893 TTGAGAATGACTGAGGAGAAAGG + Intergenic
1158623676 18:59053386-59053408 TTGGAAAAGAATGCAGAAGAAGG - Intergenic
1158748882 18:60235514-60235536 TGGGAAAAGAATGAATAGGATGG - Intergenic
1159793058 18:72808155-72808177 CTGGCAATTAATCAGGAGGAGGG + Intronic
1160118618 18:76106779-76106801 TTATAAATGAAGGAGGATGAAGG - Intergenic
1160315881 18:77846741-77846763 TTGGAAAAGCTTGAGAAGGATGG + Intergenic
1160567477 18:79796160-79796182 TGGGAAATGAATCAGCAGGGTGG + Intergenic
1160705187 19:526252-526274 TTGGAGGTGAAGGGGGAGGAAGG - Intergenic
1160896457 19:1404594-1404616 AAGGAAATGAATGGGGAAGAGGG + Intergenic
1161881185 19:6954206-6954228 TTAGAAACGAGAGAGGAGGAAGG + Intergenic
1162053069 19:8046743-8046765 TGGGAAGAGAAGGAGGAGGAGGG - Intronic
1162273393 19:9634364-9634386 TTAGAAATATATGAAGAGGAAGG + Exonic
1162563309 19:11430660-11430682 CTGGAAATGAAGGAGGAGGTGGG + Intronic
1163177171 19:15572466-15572488 TGGGGAAGGCATGAGGAGGATGG + Intergenic
1163361856 19:16851741-16851763 TTTGAAAAGGAGGAGGAGGAAGG + Intronic
1163779540 19:19239351-19239373 AGGGAAAGGAAGGAGGAGGAGGG - Intronic
1167297313 19:48659104-48659126 TTGGATATGAAGGTGGAGTATGG + Intergenic
1167448948 19:49556100-49556122 TTGAAAAGGAAGGAGGAGGCGGG + Intronic
1167474543 19:49692144-49692166 CTGGGTATGAAGGAGGAGGAGGG + Intronic
1167567339 19:50264910-50264932 TTGGAAAGGAATGAGAAGGATGG + Intronic
1168145201 19:54416465-54416487 TTCGAGATTAATGAGGAGAAAGG + Intronic
925906453 2:8542704-8542726 TAGGAAATAGATGAGGGGGAGGG - Intergenic
926243789 2:11107204-11107226 TTTGAAATGATTAAGGAGGTGGG + Intergenic
926316775 2:11715802-11715824 ATGAAAATGGAGGAGGAGGATGG + Intronic
926612517 2:14960852-14960874 TTGGCAATGGATTAGAAGGAAGG - Intergenic
926756778 2:16242918-16242940 GTGGAAATGAGGGAGGAAGAAGG - Intergenic
927623317 2:24685870-24685892 TTAGAAATCAATGTGAAGGAAGG + Intronic
928938834 2:36707366-36707388 TTGGAAATGAACAAGGGGGCAGG - Intronic
929216738 2:39422225-39422247 TTAGAAATGATTGAGAAGGCAGG - Intronic
929361605 2:41098569-41098591 GAGAAAATGAATGAGGAGGAGGG - Intergenic
929588134 2:43128679-43128701 GTGGAGAGGAATGAGGAAGAGGG + Intergenic
930247370 2:48998259-48998281 TGGTATATTAATGAGGAGGAAGG + Intronic
930253618 2:49064160-49064182 TTGAAAATGGATGAGGGAGAGGG + Intronic
930900347 2:56499116-56499138 TTCGAAAAGATTGAGGAGGAGGG - Intergenic
931132526 2:59353213-59353235 GTGGAAAGAAGTGAGGAGGAGGG - Intergenic
931764401 2:65442095-65442117 TTGGAAATGATGGTGGTGGAAGG + Intergenic
931831277 2:66054049-66054071 TAGGAAATCAATGAGGCAGAAGG - Intergenic
932104136 2:68927459-68927481 TTGCAAATGAATAAGGACCACGG + Intergenic
932537942 2:72619495-72619517 TTTAAAAAGAATGAGGAGGAGGG + Intronic
932746358 2:74337025-74337047 TTGGATATGAGTGAGGGGCAGGG - Intronic
933762921 2:85685837-85685859 TTGGAAAAGAATGATGAGTCGGG - Intronic
935043389 2:99456384-99456406 GTGCAAATAAATGAAGAGGAAGG + Intronic
935823659 2:106919445-106919467 TTGTAAATAAATCAGGAGAATGG - Intergenic
936816055 2:116462268-116462290 TTGGAAAGGCAGGGGGAGGAGGG + Intergenic
936965003 2:118118695-118118717 TTTGAAGTGAATGAGGAGAGAGG - Intergenic
938011154 2:127830083-127830105 TTGGAAATAGAGGAGGAGTAGGG - Intergenic
938507256 2:131899271-131899293 TTTGAAAAAAATGAGAAGGAAGG + Intergenic
938581506 2:132650697-132650719 TTTTAAAGGAAGGAGGAGGAAGG - Intronic
938638787 2:133258289-133258311 TTGGATTTGAGTGAGGAGCAAGG - Intronic
940440224 2:153706538-153706560 CTGGAAATGATTGAGGAGTAGGG - Intergenic
940530633 2:154872608-154872630 TTTCAAATAAATGTGGAGGAGGG - Intergenic
942772727 2:179541839-179541861 TTCACAATGAATGAGGTGGAAGG + Intronic
943055294 2:182970214-182970236 TTCCAAATAATTGAGGAGGAAGG + Intronic
943216306 2:185040861-185040883 TTGAAAGTCAATGAGGAAGAGGG + Intergenic
943726341 2:191255475-191255497 GTGTTAAAGAATGAGGAGGATGG + Intronic
944601854 2:201311251-201311273 TTCCAAAAAAATGAGGAGGAGGG + Intronic
944850445 2:203713943-203713965 TAGGAAAGAAAGGAGGAGGAGGG + Intronic
946118791 2:217490535-217490557 TTGGAAATGAAAGGGGTAGATGG - Intronic
946120524 2:217509035-217509057 TTGTCTATGAATGAGGAGGTAGG + Intronic
946415959 2:219539776-219539798 TTGGAAATGCATGGGAAAGAAGG + Exonic
946669587 2:222088603-222088625 TTGAAATTGAAGGGGGAGGAGGG + Intergenic
946971759 2:225101108-225101130 TTGGTGATGGAAGAGGAGGAAGG + Intergenic
948034383 2:234846505-234846527 GTGACAATGAATGAGGTGGAGGG + Intergenic
948963662 2:241359349-241359371 TTGGGAAGCAATCAGGAGGATGG - Intronic
1169275107 20:4228453-4228475 TTGGTAATGGATGAGGTGCAAGG + Intronic
1170007628 20:11686454-11686476 GAGGAAGTGAAAGAGGAGGACGG + Intergenic
1170668899 20:18412016-18412038 TTGGAAATTGATCATGAGGATGG - Intronic
1172211533 20:33202119-33202141 ATGGAAATGAATGAAGCAGATGG - Intergenic
1172483455 20:35285072-35285094 ATGGAAATGAAGCCGGAGGAAGG + Intergenic
1173057357 20:39628375-39628397 TTGGAATGGGATGAGGAAGATGG + Intergenic
1173870496 20:46338978-46339000 GTGGAGATGGATGGGGAGGAGGG + Intergenic
1174264599 20:49322267-49322289 TTGGAAATGATTGGTGAGGATGG + Intergenic
1175106605 20:56619552-56619574 TTGGAAATAACTGGGGTGGAGGG + Intergenic
1176280108 20:64298791-64298813 TTGGAAGTCAATCAGGAAGAGGG - Intergenic
1176293639 21:5059280-5059302 TGGCAGATGAATGAGGAGGAGGG + Intergenic
1176753820 21:10710973-10710995 TTGGAAATGAATGGGGGGAATGG - Intergenic
1176786373 21:13261055-13261077 TTTGAAAAAAATGAGAAGGAAGG - Intergenic
1176969955 21:15253670-15253692 TTGTAAGTGAAAGAGGAGGTAGG + Intergenic
1177247373 21:18545822-18545844 TTGGTAATTAATGAGGACTATGG - Intergenic
1177891724 21:26812653-26812675 TTGGAGATGAATGATGGTGATGG - Intergenic
1177984983 21:27963126-27963148 TTTGAAAAAAATGAGAAGGAAGG - Intergenic
1178168082 21:30005610-30005632 TTTGAAATAAAAGAGGAGGAAGG - Intergenic
1178179390 21:30142773-30142795 TTGTGAAAGAATGAAGAGGAAGG + Intergenic
1179356867 21:40667984-40668006 TTGGAAAGGTATTAGAAGGAAGG - Intronic
1179387088 21:40954000-40954022 TTGGATATGTTTGTGGAGGAAGG - Intergenic
1179863621 21:44204368-44204390 TGGCAGATGAATGAGGAGGAGGG - Intergenic
1180431793 22:15259563-15259585 TTGGAAGTGAAAGAGGGGTATGG + Intergenic
1180514352 22:16127491-16127513 TTGGAAGTGAAAGAGGGGTATGG + Intergenic
1180542805 22:16467248-16467270 TCTGAAAAAAATGAGGAGGAAGG + Intergenic
1181294706 22:21827468-21827490 GAGGAAATAAATGAGGAGAAAGG - Intronic
1181418249 22:22775779-22775801 CTGGATGTCAATGAGGAGGAAGG - Intronic
1181440074 22:22931203-22931225 ATGGAAATGATAGAGGAGAAAGG + Intergenic
1181443612 22:22951722-22951744 TTGAAAATTAATGACAAGGAAGG + Intergenic
1182105026 22:27682894-27682916 GTGGAAATTAAAAAGGAGGAGGG + Intergenic
1182496515 22:30712195-30712217 TTGGAGAAGAAAGAGGAGGAGGG - Intronic
1182986067 22:34718106-34718128 TTTGAAAATATTGAGGAGGAGGG + Intergenic
1183624788 22:38995218-38995240 TTGCAGATGAATGGGGAGGGGGG - Intergenic
1184238925 22:43201536-43201558 ATAGAAAAGAAGGAGGAGGAAGG + Exonic
1203306803 22_KI270736v1_random:114899-114921 GTGGAAATGAATGAAGGGAATGG + Intergenic
950135438 3:10577546-10577568 TGGGAGATTAATGAGGATGATGG - Intronic
950933765 3:16817835-16817857 TTGGAAATCAATAAGGAAGAAGG - Intronic
951911652 3:27756214-27756236 ACGGAGATGAAAGAGGAGGAAGG + Intergenic
952292445 3:32030867-32030889 TTGAAAATAATTGAGGAGGCCGG + Intronic
952467852 3:33609990-33610012 TTGGATATAGATGAGGAGGGTGG - Intronic
952740886 3:36733301-36733323 GTGGAAAGGAATGAGCAGGGTGG - Intronic
954876509 3:53806143-53806165 AGGGAAAAGAAGGAGGAGGAGGG - Intronic
955414737 3:58681461-58681483 TTGGATTTGAATGAGGAAGGAGG - Intergenic
955732339 3:61999840-61999862 TGGGAAATGAATGAGTATCAGGG + Intronic
956198714 3:66682267-66682289 TTTGAAATGAAAGAAAAGGAAGG - Intergenic
956372579 3:68579581-68579603 TTGGAAAGGACAGAGCAGGATGG - Intergenic
956478504 3:69649077-69649099 TTTGAAAGGAATGAGTAGGCAGG + Intergenic
956829663 3:73033615-73033637 CTGGAAATGAATAATGATGATGG - Intronic
957290779 3:78275778-78275800 TAGGAATTGAAAGAAGAGGATGG - Intergenic
957912276 3:86635541-86635563 TTGGAAATGTATTAGGACTAAGG - Intergenic
958105487 3:89067179-89067201 TTGGGAATGAATGAGATGAAGGG - Intergenic
958253579 3:91298815-91298837 TTGGAGATGATTGTGGAGGCTGG - Intergenic
958457784 3:94354298-94354320 TTAGAAATGAAGAAGGAAGAAGG + Intergenic
958859090 3:99423609-99423631 TAGGAAGTGAGTGAGGAGGATGG + Intergenic
959499908 3:107094316-107094338 TTGAAAAGGAATGATGAGAAGGG - Intergenic
960329008 3:116334332-116334354 TTGGAAATGTTTGAGAAGGACGG - Intronic
960470297 3:118055971-118055993 TTGGAAAAGGATGTGGAAGACGG - Intergenic
960484623 3:118236716-118236738 TTGGGAATGCATGAGAAGCACGG - Intergenic
960645186 3:119872532-119872554 TTTGACAGAAATGAGGAGGATGG + Intronic
961022989 3:123525219-123525241 TTGGAAAGGAAAAAGGTGGATGG + Intronic
961362499 3:126376747-126376769 TGGGATATGAATGGGAAGGATGG - Intergenic
961428561 3:126864348-126864370 GTGGTGATGAAGGAGGAGGAGGG - Intronic
961745152 3:129059760-129059782 TTGGCCATGCAGGAGGAGGAAGG + Intergenic
962018545 3:131471007-131471029 TGGGAAATGAGTGAGGGGCAAGG + Intronic
962615218 3:137119488-137119510 TTTGAAATGAATGAAAATGAGGG - Intergenic
962829701 3:139129171-139129193 TAGGAATGGAATGAGAAGGATGG + Intronic
963057929 3:141202389-141202411 TAGGACATGCAGGAGGAGGAAGG + Intergenic
963532878 3:146493251-146493273 TTGCAAAAAATTGAGGAGGAGGG + Intronic
963722783 3:148882768-148882790 GTGGAAGGAAATGAGGAGGAAGG + Intronic
964628163 3:158779160-158779182 TTAGAAATGAATGGGCTGGAAGG + Intronic
965294004 3:166919486-166919508 TTGCAAAAAATTGAGGAGGAAGG + Intergenic
966363562 3:179156197-179156219 TTGGAAAAGAATGGAGTGGAAGG + Intronic
966512403 3:180778624-180778646 TTCCAAATAATTGAGGAGGAGGG - Intronic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967508608 3:190283304-190283326 AAGGAAATAAATGAAGAGGAGGG - Intergenic
967567610 3:190990362-190990384 TTCCAAATAATTGAGGAGGAGGG - Intergenic
968893966 4:3388114-3388136 TGGGAAAAGAAGGAGGAGCAGGG - Intronic
969048007 4:4352227-4352249 GTAGAAATAAATGAGGAGGCCGG - Intronic
969089554 4:4683517-4683539 TGGGAAAGGAATGCGGAGGCTGG - Intergenic
969568816 4:7996026-7996048 CTGGGCATGAAGGAGGAGGAAGG - Intronic
970044861 4:11840620-11840642 TTGGAAAGCAAAGAGGAGGCAGG - Intergenic
970187171 4:13469505-13469527 TTGGAACTGAAGTTGGAGGAAGG - Intronic
970266729 4:14296530-14296552 TTGGAATTAGATGAGGAGGAAGG + Intergenic
970452435 4:16183784-16183806 TTAGAAATGAAAGAGGAAGGAGG - Intronic
971562952 4:28104795-28104817 TTGGAGATGAATGAGAGAGAAGG - Intergenic
971612366 4:28742120-28742142 ATGAAAATAAATGAGCAGGAAGG - Intergenic
972636239 4:40886533-40886555 CTGTAAAAGAATAAGGAGGAAGG + Intronic
972667478 4:41181162-41181184 TTGGAATTGAATGTGGGTGAAGG - Intronic
973313668 4:48736981-48737003 TTAGAAATGAAAGAGGTGGCCGG + Intronic
974829504 4:67172862-67172884 CTGGAGATGACTGAGGAGGCAGG + Intergenic
975169366 4:71215493-71215515 TGGGAAAGGAACGAGGTGGATGG - Intronic
975803212 4:78084679-78084701 CAGGAAATGTATGAAGAGGACGG - Intronic
975947082 4:79720059-79720081 ATGGAAAAGCATGAGGAGGAAGG - Intergenic
976009242 4:80467492-80467514 TTTGAAAAGATTGAGGAGGCGGG - Intronic
976087728 4:81423247-81423269 TAGAAAATTAAAGAGGAGGAAGG - Intergenic
976307971 4:83579909-83579931 TAGGAAATCAATGAGGAAAATGG - Intronic
976362956 4:84202306-84202328 TTAGAAATGAAACTGGAGGAAGG + Intergenic
976368781 4:84262656-84262678 TTACAAAAGATTGAGGAGGAGGG + Intergenic
976561967 4:86511893-86511915 AAGGAGAAGAATGAGGAGGAAGG + Intronic
976951667 4:90840243-90840265 GTGGAGAAGAATGAGGAGAAAGG + Intronic
977806235 4:101301316-101301338 TTGGAAATGTTTGAGTAGGGAGG - Intronic
977948300 4:102939510-102939532 TTCCAAAAAAATGAGGAGGAAGG + Intronic
978157660 4:105508458-105508480 TTTGAAATGAAAGGGGAGGCTGG - Intergenic
978506535 4:109463798-109463820 TTGGGAATGGATGAGAAGAAAGG - Intronic
978566666 4:110089855-110089877 AAGGAAAAGAAAGAGGAGGAAGG + Intronic
978578155 4:110206541-110206563 GTGGACATGAATTTGGAGGAAGG + Intergenic
978642596 4:110889246-110889268 TTGGAAATTAAAGACAAGGATGG + Intergenic
978711608 4:111789208-111789230 TTGCAAATGAAGGAGGATAAAGG + Intergenic
979654313 4:123174495-123174517 TTTGAAATGTATCAGGAAGAGGG + Intronic
979737705 4:124108014-124108036 TTAGAAAGGCATAAGGAGGAAGG - Intergenic
979780787 4:124649360-124649382 TTGTAAAAGAATGTGGAGGCAGG + Intergenic
980350297 4:131675401-131675423 TTGGGACAGAAAGAGGAGGAAGG - Intergenic
980555790 4:134402421-134402443 TTGTAAAAAATTGAGGAGGAGGG - Intergenic
980970097 4:139559469-139559491 TTGGTCTTGAATCAGGAGGAGGG + Intronic
981734036 4:147930645-147930667 TTGGAAATAAATGAGAAGATAGG - Intronic
981826514 4:148948211-148948233 TTGAAGATGAATTAGGGGGAGGG + Intergenic
982606516 4:157523356-157523378 TGGACATTGAATGAGGAGGAGGG + Intergenic
982928754 4:161375042-161375064 ATGGAAATGAATAAGCAGCACGG + Intergenic
983472677 4:168176052-168176074 TTGGAAAGAAAGGAGGAGGATGG - Intronic
983751279 4:171275070-171275092 TGGGAAATGAATGAGGAGACAGG + Intergenic
984447974 4:179861596-179861618 TTGCAAATCAAGGAGGAGGAAGG + Intergenic
986427071 5:7644267-7644289 GAGGAAATCAAGGAGGAGGATGG - Intronic
987225810 5:15840352-15840374 TTGGAAAAGAATGAGGAGGAGGG - Intronic
987896649 5:23954681-23954703 TCCCAAATAAATGAGGAGGAAGG - Intronic
988208949 5:28177614-28177636 TGGGAGAGGCATGAGGAGGAGGG - Intergenic
988502059 5:31791811-31791833 GTGGAATTGGATGAGCAGGAGGG - Intronic
988990534 5:36666104-36666126 TAGGAAGAGAGTGAGGAGGAGGG - Intronic
989299466 5:39872356-39872378 TTGCAAAAAATTGAGGAGGAAGG - Intergenic
989685738 5:44084882-44084904 TTGGCAATATATGAGGAGAAAGG - Intergenic
989970379 5:50517266-50517288 TCTGAAAAGAAAGAGGAGGAAGG - Intergenic
990445483 5:55890114-55890136 ATGGGAATGACTGAGGAAGAAGG + Exonic
991918828 5:71633054-71633076 TGGGAAACAATTGAGGAGGAGGG + Intronic
992453228 5:76892013-76892035 TTCAGAATGAAGGAGGAGGAAGG + Intronic
992511873 5:77444645-77444667 TTGGTAATGGGTGAGGAGAAAGG + Intronic
993697562 5:91079757-91079779 TTGGAGATGGATGAGGACAAAGG + Intronic
993827749 5:92713293-92713315 TTGCTAATAAATTAGGAGGAGGG + Intergenic
993909854 5:93667925-93667947 TTGGATGTGAAGGAGGAGTAAGG + Intronic
994078676 5:95682012-95682034 TTGGGAGTGAAAGAGGAGGGAGG - Intronic
994182169 5:96779503-96779525 TTGGAAATGAAAAAGAATGAAGG - Intronic
994186747 5:96823397-96823419 GTGGACTCGAATGAGGAGGATGG - Intronic
994218954 5:97172408-97172430 TTGGATATGGATGTGAAGGAAGG - Intronic
994673097 5:102785805-102785827 TTGGAAACAAATGGGGAGTAAGG + Intronic
995011902 5:107265686-107265708 TTGGGGATGGGTGAGGAGGAGGG - Intergenic
995240988 5:109885153-109885175 TTGGGAACGCATGACGAGGAGGG + Intergenic
995616392 5:113969057-113969079 TGGGGAATGAAGGAGAAGGATGG + Intergenic
995788348 5:115855852-115855874 TTTTAAAAGAATGATGAGGATGG + Intronic
996046250 5:118876833-118876855 TTCCAAAAGATTGAGGAGGAGGG + Intronic
996589733 5:125133071-125133093 TTGGCAATGAATGAGGTGGGAGG - Intergenic
997066027 5:130559951-130559973 TTGTAAATAATTGAGGAGGAGGG + Intergenic
997347119 5:133200042-133200064 TTGGAAATGATTATGGAGGAAGG + Intronic
997786093 5:136715357-136715379 TGAGAAATGCTTGAGGAGGAAGG + Intergenic
997913596 5:137901340-137901362 TTGAAAATCATTGAGGAGAAAGG + Intronic
998891980 5:146756038-146756060 TTGGAAATGCAGGAGAAGAATGG + Intronic
999928116 5:156401859-156401881 TTGGAGATGGATGATGATGATGG - Intronic
1000462953 5:161545635-161545657 GTGGGAAAGACTGAGGAGGAGGG - Intronic
1000494022 5:161955546-161955568 TTTGAAATGTATCTGGAGGAAGG - Intergenic
1000811102 5:165863151-165863173 ATAGAAAGGAATGAGAAGGAAGG + Intergenic
1000862398 5:166472439-166472461 TGGGAAATTACTGAGGAGAAGGG - Intergenic
1000978517 5:167791566-167791588 ATAGAAATGAATGAGGATAATGG + Intronic
1001334947 5:170789367-170789389 TTGGCAATGATGGATGAGGATGG + Intronic
1002221406 5:177685612-177685634 TGGCAAAGGAATGAGAAGGAAGG - Intergenic
1002278502 5:178117929-178117951 CTGGAAATGGTTGAGGAAGATGG + Intronic
1002753013 6:136454-136476 TTGGAAGTCAATCAGGAAGAGGG + Intergenic
1003217543 6:4128492-4128514 TGGGAAAGAAATGAGGAAGAGGG + Intronic
1003253066 6:4449443-4449465 GTGGAAAAGAAGGATGAGGAAGG + Intergenic
1003639587 6:7865412-7865434 TTTGAAGAGAATGAGAAGGAGGG - Intronic
1003934844 6:10964948-10964970 TTTGAAGTGAATTGGGAGGATGG + Intronic
1004241908 6:13931270-13931292 TTGGAAATGAACAAGGACAAGGG + Intronic
1005004579 6:21275045-21275067 TTGGCAATGAATGGGAATGAAGG - Intergenic
1005482439 6:26267549-26267571 TAGGAAATGAAGGTGGAGAAAGG - Intergenic
1005736424 6:28751933-28751955 TTAGAAATAAATGAGAAAGAAGG + Intergenic
1006205840 6:32342000-32342022 TGTGACAGGAATGAGGAGGAGGG - Intronic
1007342057 6:41197354-41197376 GAGGCAATGAATGAGGAGGTTGG - Intronic
1007580912 6:42959484-42959506 TTGGAAAGGAAGGAGGAGAGAGG + Intergenic
1009780661 6:68265080-68265102 ATGGAGATGAATGAAGAGCATGG + Intergenic
1011403610 6:86992029-86992051 TTGGAATTGAAAGTAGAGGATGG - Intronic
1011603497 6:89081055-89081077 TAGGAAATGAGGGAGGAAGAGGG - Exonic
1011732851 6:90283669-90283691 TTAAAAATGCATGAGGAGGCCGG - Intronic
1013044532 6:106471123-106471145 GTGGAGCTCAATGAGGAGGATGG + Intergenic
1015143977 6:129965275-129965297 CTGGAAATGGATGATGATGATGG + Intergenic
1015197994 6:130545036-130545058 TTCCTAATGATTGAGGAGGAAGG + Intergenic
1015391596 6:132688539-132688561 TAGGAAAAGATTGAGGAGGCAGG + Intronic
1015925246 6:138302991-138303013 TTTGAAATAAATTAGGAGAAAGG - Intronic
1016375125 6:143412467-143412489 AATGAAATAAATGAGGAGGAGGG - Intergenic
1016785350 6:148005496-148005518 AGGGAAAGGAAAGAGGAGGAGGG + Intergenic
1017184558 6:151587998-151588020 CAGGAAATGAATGAGGTGCAGGG + Intronic
1017296887 6:152807937-152807959 CTGGAAATGAAAATGGAGGAAGG - Intergenic
1017377106 6:153783953-153783975 TTGGATATGAATGATAAAGATGG - Intergenic
1017648378 6:156559472-156559494 TTGGAAAGGGGTGAGGAGGCTGG - Intergenic
1019035013 6:169047406-169047428 TTGGAGGTGAAATAGGAGGAGGG + Intergenic
1019749338 7:2718954-2718976 TTCCAAATGTATGAGCAGGAAGG + Intronic
1019985467 7:4652263-4652285 GAGGAAAGGAATGAGCAGGAGGG - Intergenic
1021206755 7:17789681-17789703 TTGGAAATGTAAGGGGAAGAAGG - Intergenic
1022270976 7:28807810-28807832 TTGAGAATGAAGAAGGAGGAAGG + Intronic
1022416724 7:30184741-30184763 TTGTAAATGAATGAGGGTGACGG - Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1023109047 7:36791839-36791861 TTGGCAATGAATGATGGGGTGGG + Intergenic
1023263660 7:38382499-38382521 TTGAAAATGAAGGAGATGGAGGG - Intergenic
1023282258 7:38583091-38583113 TTGAAAATGAATAAGCGGGATGG - Intronic
1023656890 7:42432277-42432299 TCTGAAATGAAAGAGGAAGAAGG + Intergenic
1024357779 7:48433606-48433628 CTGGAAATGGATGATGATGATGG - Intronic
1024439381 7:49398389-49398411 TTGGGAATGAATGGGCTGGAAGG - Intergenic
1025297123 7:57783998-57784020 TTTAAAATGAATGAAAAGGAGGG - Intergenic
1026150421 7:67783642-67783664 TGGGACCTGAATGAGGAGGATGG + Intergenic
1026374712 7:69738862-69738884 TTGGTAATCAGTGTGGAGGAAGG + Intronic
1026935172 7:74250599-74250621 CTGGAGACGAAGGAGGAGGATGG - Intronic
1028209432 7:88055200-88055222 TTGGAAAAGACTGAGAGGGAAGG + Intronic
1029407581 7:100385215-100385237 TTGGAAGGGAGTGAGGAGGCAGG + Intronic
1030365828 7:108645054-108645076 TTAGAAAAGAATAAGGTGGAAGG - Intergenic
1030718733 7:112843749-112843771 TTCCAAAAGACTGAGGAGGAGGG + Intronic
1031004154 7:116453244-116453266 TTGGAAAGGTCTGAGGAGGAAGG - Intronic
1031007784 7:116494425-116494447 TTAGAAATAAATGAGGAAGAAGG - Intronic
1031153795 7:118085523-118085545 TTGAAAATGGAGGAGGAGTAGGG - Intergenic
1031257386 7:119471337-119471359 TTCCAAAAGAATGAGGAGTATGG + Intergenic
1031429730 7:121652426-121652448 TTGCAAAAAATTGAGGAGGAGGG - Intergenic
1031647662 7:124246336-124246358 TTTTAAATGAAAGAGGAAGAAGG - Intergenic
1031984184 7:128152254-128152276 TTGGGGTTGAAGGAGGAGGAAGG - Intergenic
1032726922 7:134598602-134598624 TTCCAAAAAAATGAGGAGGAAGG - Intergenic
1032965876 7:137096833-137096855 TTCCAAAAAAATGAGGAGGAAGG + Intergenic
1033406909 7:141078746-141078768 TTGGAGGTGGATGTGGAGGAAGG + Intronic
1033410057 7:141109192-141109214 TTGGAAGTGAATGAGAGGCATGG + Intronic
1033607450 7:142937748-142937770 GTGGGAATGAATGGGGAGGGCGG - Intergenic
1034738216 7:153448824-153448846 TTGGAATTGAAAGAAGAGCAGGG + Intergenic
1034818682 7:154196970-154196992 TTGGAGATTAAAGAGGAGAAGGG - Intronic
1035195038 7:157211116-157211138 GTGGCAGGGAATGAGGAGGAAGG + Intronic
1036590893 8:10167096-10167118 TTGGAAGAGAATGGAGAGGAGGG - Intronic
1038390922 8:27200092-27200114 ATGGAAATGGATGAAGAGGAAGG - Intergenic
1038559546 8:28560039-28560061 TTGGGAATGAATGATTAGGTTGG + Intronic
1039203003 8:35117599-35117621 TTAGAAAAGAATGATGAGGCTGG + Intergenic
1039270100 8:35870533-35870555 TTAGAAATGAAAGAGGAGTGAGG - Intergenic
1039666654 8:39540677-39540699 TGGGAAATGCTTGAGGAGGAAGG - Intergenic
1039765173 8:40620921-40620943 TTGGAAATGAATAAGCAGTAGGG - Intronic
1041109884 8:54474164-54474186 GTGGAAATGCATGAGGAAGCGGG - Intergenic
1041548224 8:59070786-59070808 TTGGAAATTGATGAGGTGAATGG + Intronic
1042322750 8:67495246-67495268 ATGGGAATGGAAGAGGAGGATGG - Intronic
1042388332 8:68203289-68203311 TTGGAAATAAATCAGGATGGAGG + Intronic
1042635615 8:70870007-70870029 TATGATATGAATGAGGAGGCTGG + Intergenic
1042786386 8:72551342-72551364 TGGGAAATGAAGGAGGAATATGG - Intronic
1043058567 8:75471600-75471622 TTGGAAATTAATAAGAAGGAAGG - Intronic
1043240245 8:77924474-77924496 TTTCAAAAAAATGAGGAGGAGGG + Intergenic
1043298493 8:78697263-78697285 GTGGAAATGAATGGTGATGATGG - Intronic
1043510016 8:80941089-80941111 TTGGAAATTAATAAGGAACAAGG + Intergenic
1043741814 8:83823931-83823953 TTGTCAATGAATGAAAAGGAAGG - Intergenic
1044130545 8:88518233-88518255 TTGGGAAAGAATGAGGCAGAAGG - Intergenic
1044435751 8:92161012-92161034 TTAGAAATGAATGATAATGATGG + Intergenic
1044516677 8:93146871-93146893 TTCCAAATAATTGAGGAGGAGGG + Intronic
1044570124 8:93708911-93708933 TTGGAAATGACTAAGGAGAGTGG - Intronic
1044711367 8:95061482-95061504 TTGGAAATGGGTCAGAAGGAGGG + Intronic
1045264611 8:100608716-100608738 TAGGAAACGAAAGAGGTGGAGGG - Intronic
1046796735 8:118381562-118381584 TTAGAAGTGAAAGAGGAAGAAGG + Intronic
1047819944 8:128507804-128507826 TTGGCACGGTATGAGGAGGATGG + Intergenic
1047972220 8:130095048-130095070 TTTGAAATGATTCAGGAGGTTGG - Intronic
1048509833 8:135052166-135052188 GGGGAAATGATTGAGGAGGGGGG + Intergenic
1048940553 8:139396853-139396875 GTGGAAATGAAGGAGAAGCAAGG - Intergenic
1048951530 8:139500876-139500898 TTGTGAATGGAGGAGGAGGAAGG + Intergenic
1050099104 9:2099506-2099528 TGGGAAAGGATAGAGGAGGAGGG + Intronic
1050385879 9:5090161-5090183 TTCGATATCAATGAGGAGAAAGG + Intronic
1050452021 9:5791979-5792001 TTGGAAATGATGGGAGAGGAGGG + Intronic
1050667692 9:7959776-7959798 TTGGAATTGTAGGAAGAGGAAGG - Intergenic
1050675662 9:8049968-8049990 TTTGAAAAAACTGAGGAGGAGGG - Intergenic
1050689510 9:8209466-8209488 TTGAAAATGAATGAGAAATATGG - Intergenic
1051146766 9:14035154-14035176 GTGAAAATGTATGAGGATGAGGG + Intergenic
1051713790 9:19960424-19960446 TTGGAAACCAATGAGGTGGAAGG + Intergenic
1051749969 9:20330606-20330628 TTGGTAACAAATGGGGAGGAAGG - Intergenic
1053523026 9:38800820-38800842 TTTGAAATGAATGAGAACAATGG + Intergenic
1053571381 9:39312199-39312221 TTGGAAGTAAAAGAGAAGGAAGG - Intergenic
1053782412 9:41624310-41624332 TTGGGACAGAAAGAGGAGGAAGG + Intergenic
1053837214 9:42152478-42152500 TTGGAAGTAAAAGAGAAGGAAGG - Intergenic
1054092943 9:60870897-60870919 TTGGAAGTAAAAGAGAAGGAAGG - Intergenic
1054114419 9:61146809-61146831 TTGGAAGTAAAAGAGAAGGAAGG - Intergenic
1054125764 9:61306813-61306835 TTGGAAGTAAAAGAGAAGGAAGG + Intergenic
1054170367 9:61834467-61834489 TTGGGACAGAAAGAGGAGGAAGG + Intergenic
1054195251 9:62025240-62025262 TTTGAAATGAATGAGAACAATGG + Intergenic
1054593335 9:67035712-67035734 TTGGAAGTAAAAGAGAAGGAAGG + Intergenic
1054643157 9:67563449-67563471 TTTGAAATGAATGAGAACAATGG - Intergenic
1054667170 9:67746348-67746370 TTGGGACAGAAAGAGGAGGAAGG - Intergenic
1054715828 9:68557068-68557090 TTGGATATGAAGGAGAGGGAAGG - Intergenic
1055045985 9:71924230-71924252 TTGGAAAAGAATTAGGACTAAGG - Intronic
1055336004 9:75234285-75234307 TTAGAAACGAATGAGGAGGAAGG + Intergenic
1055829016 9:80358707-80358729 TGGGAGAGGAAAGAGGAGGAGGG + Intergenic
1055979266 9:81985974-81985996 TTAGAAAAGAATGTGTAGGAAGG + Intergenic
1055984700 9:82045441-82045463 TTATAAATGAAAGAGGAGGTCGG - Intergenic
1056164496 9:83928136-83928158 TTGAGAAGGAATGAGGAAGATGG + Intergenic
1056958262 9:91099764-91099786 TAGAAAATGAAAGAGGAGGAGGG + Intergenic
1057016533 9:91657435-91657457 TTAGAAAGGAAGGAGGAGGCTGG - Intronic
1057737152 9:97673778-97673800 TTGAAAATGAAAGATGAGGAAGG + Intergenic
1058101553 9:100922936-100922958 TTTGAAAAAATTGAGGAGGAGGG + Intergenic
1058347818 9:103985264-103985286 TTCCAAATGACTGAGAAGGAGGG + Intergenic
1059151171 9:111950949-111950971 TGGGAATTGAGTGAGGAGGCAGG - Intergenic
1059873493 9:118604438-118604460 TTGGAAATTGTTGAGGAGGAGGG + Intergenic
1061048963 9:128182975-128182997 TTGGACAGGAATGGGGAGGGTGG - Intronic
1061327199 9:129871105-129871127 CTGGAGATGAATGGGGAGGATGG - Intronic
1062497115 9:136837188-136837210 TTGGAAGTGGATGGGGATGATGG + Intronic
1186379297 X:9040243-9040265 TTAGCAATAAATGAGGAGGTTGG + Intronic
1186757423 X:12687347-12687369 TTGATAATGAATGAGGAAAAAGG - Intronic
1187049864 X:15685187-15685209 TTTGGAAAGAATGAGGAGAATGG + Intergenic
1187620600 X:21049160-21049182 TTCTAAAAAAATGAGGAGGAGGG + Intergenic
1187637905 X:21252983-21253005 TTGGAAAAGAAACAGCAGGATGG - Intergenic
1188073765 X:25749781-25749803 TAGGAAAGGAAAGAGGAGGATGG - Intergenic
1188711584 X:33406860-33406882 TTCCAAATGATTGAGGAGGAAGG - Intergenic
1189940331 X:46114416-46114438 TTCCAAATAATTGAGGAGGAGGG - Intergenic
1190497179 X:51037847-51037869 TAGGAAAAGGATGAGGAGGAGGG + Intergenic
1191917712 X:66220566-66220588 GTGGAAATGAATGTGGATGCTGG - Intronic
1191919229 X:66236648-66236670 TTGCAAAAAAATGAGAAGGAGGG - Intronic
1191967256 X:66772944-66772966 TTCCAAATGATAGAGGAGGAGGG - Intergenic
1193353190 X:80485334-80485356 TTTGAAAAGAATGAGAAGGTAGG - Intergenic
1194519272 X:94898409-94898431 TTCCAAATAATTGAGGAGGAGGG - Intergenic
1194757194 X:97750992-97751014 TTGGAAATGTAGGAGGTGAATGG - Intergenic
1194771282 X:97908961-97908983 CTAGAAATGAATGATGATGAAGG + Intergenic
1195011127 X:100733021-100733043 TAAGAAATGAATGAGAAGTAAGG - Intergenic
1195789892 X:108572531-108572553 ATGGAATTGAATGAGGTGGTGGG - Intronic
1196473431 X:116054999-116055021 TTGGAAAAAATTGAGGATGAGGG - Intergenic
1197174434 X:123470206-123470228 AAGGAAATGAGGGAGGAGGATGG + Intronic
1197684577 X:129425973-129425995 TCGGAAATGAAAAAGGAGGGCGG - Intergenic
1197748362 X:129948123-129948145 TTGGATCTGAATGTGGGGGATGG + Intergenic
1198233594 X:134716109-134716131 CTGGAAAGGAAAGGGGAGGAGGG - Intronic
1198367000 X:135951218-135951240 CTGGAAACGAAGGATGAGGAAGG - Intergenic
1198416065 X:136420955-136420977 TTAGGAATGAATGAGTAGGTAGG + Intergenic
1199838484 X:151618803-151618825 TTGGATGTGAATGAGGAGTTGGG + Intronic
1199899360 X:152157957-152157979 TTGGAAAGGAATAAAGATGAGGG + Intergenic
1199917427 X:152359092-152359114 TTCCAAATAACTGAGGAGGAAGG - Intronic
1201132827 Y:10967773-10967795 ATGGAATTGAATGAAAAGGAAGG - Intergenic
1201197863 Y:11511868-11511890 ATGGAAACGAATGTGAAGGAAGG + Intergenic
1201384984 Y:13430246-13430268 TTGCAAAAAAATGAGGAGGAGGG - Intronic
1201553752 Y:15246720-15246742 TGGGAAATGAAAGAGCTGGAAGG - Intergenic
1201934943 Y:19400077-19400099 TTTCAAATAATTGAGGAGGAGGG + Intergenic