ID: 1093150763

View in Genome Browser
Species Human (GRCh38)
Location 12:15618360-15618382
Sequence ATCACAGAGGTGGTTATAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 200}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093150763 Original CRISPR ATCACAGAGGTGGTTATAAT AGG (reversed) Intergenic
900783375 1:4632158-4632180 ATCACAGAGGTCTTTGTAAGAGG - Intergenic
901756020 1:11442026-11442048 TTCAAAGAGGTGGTTATTTTGGG + Intergenic
902850493 1:19152062-19152084 ATCAAAGAGGTGGTTAATACTGG - Intronic
904397942 1:30235365-30235387 ATCAAAGGGGAGGTTATACTGGG - Intergenic
905258516 1:36701050-36701072 TTCACAGAGGAGGTGATACTTGG - Intergenic
906252614 1:44322465-44322487 ATCAGAGATATGTTTATAATAGG - Intronic
908361339 1:63370996-63371018 ATGACAGTAGTGGTTTTAATAGG + Exonic
908759382 1:67498026-67498048 ATCACAGGGGTCCTTATAAGAGG + Intergenic
910927058 1:92408525-92408547 ATCACAGAAGAAGTTATCATGGG + Intergenic
912638872 1:111324514-111324536 ATCACAGAGCTGGTAATTAGTGG + Intergenic
917189671 1:172401336-172401358 ACCACAGAAGTGGGTATATTAGG + Intronic
918424641 1:184395832-184395854 ATCACAGAGAGGGATATATTTGG + Intronic
919604537 1:199665458-199665480 AACACAGATGTCGTTTTAATGGG + Intergenic
920056804 1:203198746-203198768 ATCACAGAGGTCCTTATGAGCGG + Intergenic
920134292 1:203757075-203757097 CTCACAGAGGTGGTGGTACTTGG + Intergenic
920737808 1:208550771-208550793 ATCACAGTAGTATTTATAATAGG + Intergenic
920883294 1:209900077-209900099 ATCACAAAGCTGGGTATCATAGG - Intergenic
922150402 1:222997997-222998019 AATACAAAGGTGTTTATAATTGG - Intronic
922340265 1:224649213-224649235 ATCACAGAGGTCTTTATAGGTGG + Intronic
923510236 1:234645099-234645121 ATCAGAGATGTGGAAATAATAGG + Intergenic
1074390039 10:113049490-113049512 ATGGCAGAGGTGGTGATAAGCGG - Intronic
1074425099 10:113343662-113343684 ATCACAGGGGTGCATATAAGAGG + Intergenic
1076008518 10:126967737-126967759 ATCACAAAGGTCCTTATAAGAGG - Intronic
1079587536 11:22144527-22144549 GTCACAGAAGTAGTTATAAGGGG + Intergenic
1080807289 11:35664841-35664863 AGAAGAGAGATGGTTATAATTGG - Intronic
1080898978 11:36469560-36469582 ATCACAGAGGTGGTAACTACAGG - Intergenic
1080975143 11:37330441-37330463 ATCACAAATGTGGTAATATTAGG - Intergenic
1081637793 11:44732243-44732265 ATCCCAGAGATGATTATCATGGG + Intronic
1083353194 11:62045883-62045905 ATCACAGAGGTGGATCTAGAAGG + Intergenic
1084493841 11:69492442-69492464 ATCACAAGGGTGCTTATAAGTGG + Intergenic
1085986316 11:81792502-81792524 ATCCCAGCTGTGGTTACAATGGG - Intergenic
1086120236 11:83298143-83298165 TCCACTGTGGTGGTTATAATTGG + Intergenic
1086264445 11:84980918-84980940 TTCCCAGAGCTGGTTATATTGGG + Intronic
1086511832 11:87566584-87566606 ATGACTGAGTTGGTTATAATGGG - Intergenic
1092483394 12:8880732-8880754 ATTACACAGGTGGTTTTATTCGG + Intronic
1093150763 12:15618360-15618382 ATCACAGAGGTGGTTATAATAGG - Intergenic
1094559032 12:31532431-31532453 ATCACTGAGGTGGCTTTAAGTGG + Intronic
1095618622 12:44222702-44222724 ACCACAGAGGTGGAGAGAATAGG - Intronic
1104227457 12:126849699-126849721 ATCACAGAAGTGCTTATAAGTGG - Intergenic
1107691787 13:42960855-42960877 ATCACAGAGGTCCTTAAAATTGG - Intronic
1107893070 13:44930992-44931014 ATCACAGAGGTAAGAATAATAGG - Intergenic
1109050551 13:57475994-57476016 ATCAGCGAGATGGTTAAAATAGG + Intergenic
1109427607 13:62187046-62187068 ATCACAGAGGTTATTACAAACGG + Intergenic
1112711162 13:102130454-102130476 ATCACAAAGGTCTTTAAAATTGG - Intronic
1115747507 14:36452335-36452357 ATCACATAGGTCCTTAAAATTGG + Intergenic
1115917837 14:38336896-38336918 AACACGGAGGAGGGTATAATGGG - Intergenic
1118009238 14:61592488-61592510 ATCACAGGGGTTCTTATAAGAGG - Intronic
1120063740 14:80015404-80015426 ATCACAGGGGTCCTTATATTGGG - Intergenic
1120196653 14:81491589-81491611 ATCACAAAGGTTTTTACAATAGG - Intronic
1120673264 14:87388615-87388637 ATCCCACAGGTGGTTCTGATGGG - Intergenic
1121378376 14:93435231-93435253 ACCACAAAAATGGTTATAATAGG - Intronic
1123126639 14:105951697-105951719 ATCACAGGGGTGCTTATAAGTGG + Intergenic
1123407149 15:20027798-20027820 ATCACAAGGGTGCTTATAAGTGG + Intergenic
1123516479 15:21034454-21034476 ATCACAAGGGTGCTTATAAGTGG + Intergenic
1124638669 15:31381457-31381479 ATCACAGAGGTCCTTATAAGAGG - Intronic
1124912249 15:33933176-33933198 ATCACAAAGGTTATTATTATAGG + Intronic
1125109804 15:36019013-36019035 ATCACAGAGATGCTTAGAAAAGG - Intergenic
1127956127 15:63855126-63855148 ATCACAAAGGTCCTTATAAAAGG - Intergenic
1128679659 15:69638928-69638950 AACATAGAGATGTTTATAATAGG - Intergenic
1129797692 15:78390604-78390626 AGGTCAGAGGTGTTTATAATTGG - Intergenic
1131352596 15:91715067-91715089 ATCACAGAGGTGGTTTCAAATGG + Intergenic
1132018517 15:98339827-98339849 ATCACAAAGGTCTTTATAAACGG - Intergenic
1133723234 16:8514471-8514493 ATCACAGGGGTTCTTATAAGAGG - Intergenic
1135960650 16:26992107-26992129 ATCACAGAGGTCTTTATAAGAGG - Intergenic
1139110265 16:63881806-63881828 TTTTCAGAGGTGGTTAGAATGGG + Intergenic
1141017469 16:80464111-80464133 ATCACAGAGGAAGGTTTAATTGG - Intergenic
1141206265 16:81935265-81935287 ATCACAAGGGTCCTTATAATAGG - Intronic
1141729997 16:85815777-85815799 ATCACGTAAGTGGTTATTATGGG - Intergenic
1146080547 17:29776426-29776448 ATCACAGTGGTGGCTTTACTTGG - Intronic
1153143337 18:2000330-2000352 ATCACAAAGGTCTTTATAAGAGG + Intergenic
1155592671 18:27445864-27445886 ATCACAGGGATCCTTATAATGGG - Intergenic
1166096838 19:40545008-40545030 ATCACAGCAGAGTTTATAATGGG - Intronic
926820999 2:16851746-16851768 ATCACAAAGGTCCTTATAAGAGG - Intergenic
927410313 2:22817500-22817522 ATCACAAAGGTCCTTATAAGAGG - Intergenic
927417178 2:22891552-22891574 ATCACACAGGGGGATATGATGGG - Intergenic
927874388 2:26645219-26645241 ATCACAGAGAGGGTTTTCATTGG + Intergenic
928293027 2:30056687-30056709 ATCACAGAGCTGGTAAGAAGCGG + Intergenic
929081752 2:38128442-38128464 ATCACAGGGGTGGTTTTTAATGG + Intergenic
929312366 2:40440304-40440326 ATCACAAAGGTGGTCCTAAAAGG + Intronic
930112881 2:47694248-47694270 ATCATAGAGGTGATTTTATTGGG + Intergenic
930319988 2:49842767-49842789 AGCACAGAGGGAATTATAATGGG - Intergenic
930743556 2:54858278-54858300 ATCTAAGAGGAGGTTATAAAAGG - Intronic
930845630 2:55900432-55900454 CTCACAGAGGTTTTTATTATTGG + Intronic
931761395 2:65420294-65420316 AACACGGAGGTGGGTACAATGGG - Intronic
932570992 2:72938361-72938383 ACCCCAGAGCTGGTAATAATGGG + Intergenic
932742519 2:74302725-74302747 ATCACAGAAGTAGTTATAGATGG - Intronic
932777180 2:74535405-74535427 ATAACAGAGGTGGTGATGAGTGG - Exonic
933283997 2:80364773-80364795 GACACAGAGGTGATTATAAAAGG - Intronic
933324914 2:80823290-80823312 ATCTCAGAGGTGGTTTCTATGGG + Intergenic
934128140 2:88919147-88919169 ATTACAGTGGTGGTTATAGAAGG + Intergenic
934151291 2:89150101-89150123 ATCACAAAGGTCCTTATAATTGG + Intergenic
934215967 2:90031809-90031831 ATCACGAAGGTCCTTATAATTGG - Intergenic
934305103 2:91815264-91815286 ATCACAAGGGTCCTTATAATAGG - Intergenic
934328154 2:92037484-92037506 ATCACAAGGGTCCTTATAATAGG + Intergenic
934466534 2:94268023-94268045 ATCACAAGGGTCCTTATAATAGG + Intergenic
934986079 2:98885637-98885659 ATCTCAGAGGTGGTAAAAACTGG + Intronic
935429492 2:102959784-102959806 GTCACATAGGTGGTTATGAAAGG - Intergenic
937029603 2:118727363-118727385 ATCACAAAGGTCTTTATAAAAGG + Intergenic
937159295 2:119745195-119745217 ATCACAGATGTAGTCTTAATGGG - Intergenic
940570781 2:155430118-155430140 AGCACAGAGGTGCTTTAAATAGG - Intergenic
940758920 2:157716171-157716193 ATCACAAAGGTCCTTAAAATTGG - Intergenic
941625054 2:167822312-167822334 TAAACAGAGCTGGTTATAATAGG + Intergenic
941745004 2:169077878-169077900 ATAACAGAGGAGGTTATGAGGGG + Intronic
944463070 2:199972423-199972445 ATCACAGATGTCCTTATAAAAGG + Intronic
945556562 2:211283135-211283157 ATCACAAATGTTGTTATAAGAGG + Intergenic
946477782 2:220025256-220025278 ATCTTAGAGGTGGAAATAATAGG + Intergenic
1169453011 20:5728371-5728393 ATCACAAAGGTCCTTATAAGAGG + Intergenic
1174073006 20:47912029-47912051 ATCACAGGGGTCCTTATAAGAGG - Intergenic
1174151056 20:48486612-48486634 ATCACAGGGGTCCTTATAAGAGG + Intergenic
1174433553 20:50489085-50489107 ATCACAGGGGTCCTTATAAAAGG - Intergenic
1176798166 21:13390659-13390681 ATCACAGAGGTGATGTTATTAGG + Intergenic
1178029020 21:28503827-28503849 ATCACAGGGGTCCTTATAAGAGG + Intergenic
1179340749 21:40506766-40506788 ATCAGATTGGTGGTTATAAAGGG + Intronic
1183045300 22:35214674-35214696 ATCACAGAGATTCTGATAATTGG + Intergenic
949736694 3:7180736-7180758 TTTACAGAGGTCTTTATAATCGG - Intronic
950387820 3:12673810-12673832 ATAGCAGAGGTGGTTGCAATAGG - Intergenic
952136120 3:30422576-30422598 AACACGGAAGTGGTGATAATGGG + Intergenic
952196826 3:31084617-31084639 ATCACAGGGGTCCTTATAAGAGG + Intergenic
953540300 3:43812301-43812323 TTCCCAGAGGTGGATTTAATGGG + Intergenic
954926331 3:54238514-54238536 ATCACAGAGCTTCTTATGATTGG + Intronic
955036269 3:55271017-55271039 ATCTCACAGTTGGTAATAATAGG + Intergenic
957852423 3:85826505-85826527 ATGACAGAGATTGTTTTAATAGG + Intronic
960247471 3:115415125-115415147 ATCACACAGGTCCTTAAAATTGG - Intergenic
960329394 3:116339606-116339628 AGCACAGAGGAGGTGATACTCGG + Intronic
960465143 3:117988938-117988960 CTCACAGAGTTGTTGATAATAGG + Intergenic
962405743 3:135098549-135098571 ATCACAGTGTTATTTATAATAGG - Intronic
964159630 3:153631204-153631226 ATCACAAATGTTGATATAATGGG + Intergenic
965188608 3:165499746-165499768 ATCACAGGGGTTCTTATAAGAGG + Intergenic
966127003 3:176590177-176590199 ATCACAAAGGTGTATATACTGGG + Intergenic
968856563 4:3128528-3128550 ACCACAGATCTGTTTATAATAGG - Intronic
969212288 4:5696966-5696988 ATCACAGATGTCCTTATAAGAGG + Intronic
969342746 4:6552603-6552625 ATCACAGGGGTCCTTATAAGAGG - Intronic
970906538 4:21223142-21223164 ATCACAGGGGTCCTTATAAGTGG + Intronic
971962762 4:33510127-33510149 AGCACAGAGATATTTATAATGGG - Intergenic
972231001 4:37072817-37072839 CTCACAGAGTGGGTTATAACAGG - Intergenic
975192821 4:71485525-71485547 ATCACAGAGGGAATTAAAATAGG - Intronic
975957854 4:79863552-79863574 AACACAGATGAGGTTATATTAGG - Intergenic
977407688 4:96620848-96620870 CTGACAGAGGTGGTCAAAATGGG - Intergenic
978285991 4:107077231-107077253 AGCACAGTGTTGTTTATAATAGG + Intronic
978847858 4:113295552-113295574 CTCACAGAGGGGGTTCTAAAAGG - Intronic
982306469 4:153936858-153936880 ATCACAGATCTGGTTACATTGGG - Intergenic
983807839 4:172017593-172017615 ATCACAGTGCTGGGTATAGTAGG - Intronic
985861813 5:2477351-2477373 ATGACAGAGGTGGTTCTAGGAGG - Intergenic
986652774 5:9980669-9980691 AGCACATAGGTGATTATATTAGG + Intergenic
986745934 5:10744976-10744998 ATCTCAGAGCTGTTTATTATTGG - Intronic
987548373 5:19344168-19344190 ATCACAGAGGTGGGAGTAAGAGG - Intergenic
988188290 5:27896921-27896943 ATCACAAGGGTGGTTACAAATGG + Intergenic
988262335 5:28904264-28904286 CTTACAGTGGTGGTTAAAATTGG + Intergenic
991966430 5:72096101-72096123 ATCACAAGGGTCCTTATAATAGG - Intergenic
992016129 5:72577108-72577130 ATAACAGAGGTGATGAGAATTGG + Intergenic
993232871 5:85260815-85260837 ATCAGAGAAGTTGTTATCATTGG + Intergenic
993488438 5:88515561-88515583 ATCACCAATGTGGTGATAATGGG - Intergenic
994066618 5:95550587-95550609 AATATAGAGGTGGTAATAATTGG - Exonic
995952102 5:117728514-117728536 TTCACAAAGGTGGTTATCACTGG + Intergenic
995997883 5:118322863-118322885 ATCCCAGATGTGGTTAAAAGGGG - Intergenic
996796605 5:127354691-127354713 ATGACAGAGGTAGGTATAACAGG - Intronic
999519447 5:152335706-152335728 ATCAAGGAGGTTGTTATAACTGG + Intergenic
1003492920 6:6639658-6639680 ATCACAGAGGTCCTTATAAGAGG - Intronic
1003580442 6:7335167-7335189 ATCACAGGGGTCCTTATAAGAGG - Intronic
1004576471 6:16900523-16900545 ATCCCAGAGGTCCTTATAAAAGG + Intergenic
1006010608 6:31039990-31040012 ATCACAAAGGTCCTTATAAGAGG + Intergenic
1010462123 6:76125491-76125513 ATCAAAGATGTGGTTATGACAGG - Intergenic
1010779328 6:79926656-79926678 AAAACAGAGGTGGTTATCTTGGG + Intronic
1011397826 6:86928735-86928757 ATCACAGAGTTCTTTAAAATGGG - Intergenic
1011820942 6:91253484-91253506 ATCACAGAGAGTGTTAAAATTGG - Intergenic
1012342222 6:98141928-98141950 ATCACAGAGATTCTTAAAATTGG - Intergenic
1014018541 6:116562701-116562723 ATCACAAGGGTGCTTATAAAAGG + Intergenic
1014081497 6:117291933-117291955 GTCACAGAGGTTGCCATAATGGG - Intronic
1017255584 6:152329716-152329738 ACCAGACAGGTGGGTATAATAGG - Exonic
1018802490 6:167235345-167235367 ATCAGAGAGGGGCTTATAGTAGG + Intergenic
1019581452 7:1765586-1765608 ATCACAAAGGTCCTTATAAGAGG + Intergenic
1019838014 7:3409913-3409935 AGCACAGAGGTGATCATAACAGG + Intronic
1020190285 7:5991159-5991181 ATCAGAAATGTGGTTTTAATAGG - Intronic
1021131850 7:16921316-16921338 GTCACAGGGGTGTTTATAAAAGG - Intergenic
1021462348 7:20902551-20902573 ATCACAGGGGTCCTTATAAATGG + Intergenic
1022610585 7:31867564-31867586 ATCATAGAGGTGGCTACAACAGG - Intronic
1026639426 7:72111160-72111182 ATCTTGGAGGTGGTTAAAATTGG - Intronic
1028505288 7:91563781-91563803 GTCACAGAGATTTTTATAATTGG + Intergenic
1029682268 7:102119659-102119681 AACCCAGAAATGGTTATAATCGG - Intronic
1031763577 7:125745133-125745155 AGCACAGAGCTCGTTATTATTGG + Intergenic
1033183560 7:139204114-139204136 ATCACAGAGGTCCTTAAAAGTGG + Intergenic
1033377660 7:140779148-140779170 ATCACAGTGGTGGTTACCCTTGG + Intronic
1038068160 8:23984673-23984695 ATCCCAGAGATGGGTAGAATGGG + Intergenic
1038114920 8:24543201-24543223 ATCACAGTGGTGATTATGAGTGG - Intergenic
1038959004 8:32498176-32498198 ATCAAAGAAGTGGTTAGACTAGG + Intronic
1040886617 8:52270365-52270387 ATCACAGCATTGTTTATAATGGG - Intronic
1042106671 8:65334865-65334887 AGCACATAGGTGCTTATATTAGG - Intergenic
1044827023 8:96208490-96208512 ATCACATAGGTCCCTATAATGGG - Intergenic
1044966129 8:97575661-97575683 ATCACAGGGGTCCTTATAAGAGG + Intergenic
1045240712 8:100398684-100398706 ATAACAGATGTGGTTATAATAGG - Intronic
1045779505 8:105847429-105847451 AGCAAAGAGGTGGTTTTAAATGG + Intergenic
1048409488 8:134157144-134157166 ATAAGACAGGTGGTTAAAATAGG - Intergenic
1049451276 8:142663314-142663336 TTCACAGAGGCGGTTGTAAGAGG - Intronic
1053696582 9:40644794-40644816 ATCACAAGGGTCCTTATAATAGG + Intergenic
1053943004 9:43275004-43275026 ATCACAAGGGTCCTTATAATAGG + Intergenic
1054307832 9:63444022-63444044 ATCACAAGGGTCCTTATAATAGG + Intergenic
1054406557 9:64768024-64768046 ATCACAAGGGTCCTTATAATAGG + Intergenic
1054440187 9:65253497-65253519 ATCACAAGGGTCCTTATAATAGG + Intergenic
1054490218 9:65768442-65768464 ATCACAAGGGTCCTTATAATAGG - Intergenic
1055012126 9:71578633-71578655 ATCACAGTAGTGGTTATATTGGG - Intergenic
1055608878 9:78000484-78000506 ATTACAGATGTGGTTATTTTAGG - Intronic
1058463215 9:105202590-105202612 ATTACAAAGGTGGTTCTCATGGG + Intergenic
1062702609 9:137915387-137915409 GTGATAGAGGTGGTTAAAATGGG + Intronic
1202779032 9_KI270717v1_random:18454-18476 ATCACAAGGGTCCTTATAATAGG + Intergenic
1203586101 Un_KI270747v1:4863-4885 ATCACAAGGGTCCTTATAATAGG + Intergenic
1186437261 X:9553212-9553234 ATCACAGAGGTGCTTCTGAGTGG + Intronic
1186701288 X:12092914-12092936 GTCAATGAGGTGGTTAGAATAGG + Intergenic
1186959973 X:14725299-14725321 ATCACAGACCTGGATATAAGAGG - Intronic
1188138458 X:26518979-26519001 ATCACAAAGGTCCTTATAAGTGG + Intergenic
1188355716 X:29188299-29188321 ATCACATTGGTGGTAATTATTGG - Intronic
1190097911 X:47497165-47497187 ATCACAGGTGTCGTTATAAGAGG - Intergenic
1195763010 X:108267234-108267256 ATCACAAGGGTGCTTATAAGTGG - Intronic
1198083478 X:133261618-133261640 ATCACAGAGGTGTTTATAAGAGG + Intergenic