ID: 1093163247

View in Genome Browser
Species Human (GRCh38)
Location 12:15774335-15774357
Sequence TAGGCCTGTATGCAAGTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 62}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093163247_1093163249 22 Left 1093163247 12:15774335-15774357 CCTGCAACTTGCATACAGGCCTA 0: 1
1: 0
2: 0
3: 4
4: 62
Right 1093163249 12:15774380-15774402 ACAGCTATTACTCTTCAGTTAGG 0: 1
1: 0
2: 4
3: 16
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093163247 Original CRISPR TAGGCCTGTATGCAAGTTGC AGG (reversed) Intronic
901455751 1:9361856-9361878 AAGGCCTGTTTGCAAGCAGCAGG + Intronic
904211669 1:28889934-28889956 TGGGCCTGTATGACAGTTCCTGG + Intronic
909077839 1:71074208-71074230 TAGGCCACTGTGCAAGGTGCTGG - Intronic
912313444 1:108645829-108645851 AAGGCCTGTATCCAGGTTGGGGG + Intergenic
913711792 1:121491663-121491685 TAAGGATGTATGCAAGATGCTGG + Intergenic
915205647 1:154268803-154268825 TAGGGCTGAAGGCAAGTTGAAGG - Exonic
915910138 1:159909809-159909831 CAGGCCTCTATGCAACTTGGAGG - Intergenic
919431924 1:197504597-197504619 TAGGCCTGTCAGAAAGATGCAGG + Intergenic
923281742 1:232449568-232449590 TAGGTCTGTCTGGTAGTTGCCGG - Intronic
1067097634 10:43312979-43313001 TGGGCCTTTCTGGAAGTTGCTGG + Intergenic
1070809210 10:79289206-79289228 TAGGCCTGTACCCACATTGCTGG + Intronic
1077801195 11:5539473-5539495 TTGGCCTAGATACAAGTTGCAGG + Intronic
1084463828 11:69310720-69310742 TTGGCCTGGATGCAAGTGCCAGG + Intronic
1089176604 11:116553112-116553134 TAGACCTGTCTGGAAGTTGGGGG + Intergenic
1090691358 11:129186206-129186228 TAGACCTGTATAAAAGTTCCTGG - Intronic
1091910200 12:4224436-4224458 GCAGCCTGTATGCACGTTGCAGG + Intergenic
1093163247 12:15774335-15774357 TAGGCCTGTATGCAAGTTGCAGG - Intronic
1106419687 13:29575842-29575864 TAGGCCTTTCTGGAAGTTGCAGG - Intronic
1111377776 13:87402896-87402918 TAGGCCTGTATTAAAGATGCAGG - Intergenic
1119762606 14:77162354-77162376 TAGGCTAGTAAGGAAGTTGCTGG + Intronic
1126492711 15:49257160-49257182 TAGGCATTTGTGCTAGTTGCTGG + Intronic
1132648889 16:1011620-1011642 TAGGCCTGTCTCCAGGCTGCGGG + Intergenic
1134026337 16:10956731-10956753 CAGGCCTGAATGCCAGGTGCTGG - Intronic
1139426883 16:66886486-66886508 TAGGCGTGTTTGCAAGTTTAAGG - Exonic
1147817002 17:43217498-43217520 TAGGGCTGTCTGGAAGCTGCTGG + Intronic
1155282984 18:24259591-24259613 TGGGCCTGTATGGCAGTTTCAGG - Intronic
1160929795 19:1565096-1565118 TATGCCTGGACCCAAGTTGCTGG - Intronic
927217567 2:20676704-20676726 AAGGCCTGTCGCCAAGTTGCAGG - Intergenic
931073842 2:58686617-58686639 TGGACATGTATGCAACTTGCAGG + Intergenic
935036549 2:99381290-99381312 TAGGCCTGTATTAAAGTTCTTGG + Intronic
935213884 2:100960755-100960777 AAGGTCTGTGTGCTAGTTGCTGG + Intronic
941482717 2:166037831-166037853 TGGGACTGTATGGAGGTTGCTGG - Exonic
941513382 2:166441451-166441473 TGGGACTGTATGGAGGTTGCAGG - Exonic
947932597 2:233975995-233976017 TTGGCCTGGATGGAAGCTGCAGG + Intronic
1173653599 20:44683557-44683579 TAGGACTGGATGCTAGTGGCTGG - Intergenic
1173815612 20:45985869-45985891 TTGGCCTGAAAGCAAGTGGCTGG + Intergenic
1177920782 21:27149606-27149628 TATTCCTGGGTGCAAGTTGCTGG - Intergenic
1181866070 22:25856476-25856498 CAGCTCTGTATGGAAGTTGCTGG - Intronic
949452841 3:4206119-4206141 TAAGCCAGTATCCAAGGTGCAGG + Intronic
951306945 3:21075645-21075667 TAGGGCTGTATAAAAGTTGCTGG - Intergenic
954848923 3:53583744-53583766 TAAGTAGGTATGCAAGTTGCTGG + Intronic
954860626 3:53686977-53686999 TATTCCTGTATACAAGCTGCAGG + Intronic
959488562 3:106958114-106958136 TAGCCCTGTGTGAAAGTTACAGG - Intergenic
962014137 3:131423126-131423148 TTGGCCTGTATGCAAGGGGAGGG - Intergenic
967016463 3:185486882-185486904 TAGACCTGTTTGCAAGATGGTGG + Exonic
970929477 4:21492866-21492888 TAGGCCTGAATGGAAACTGCAGG - Intronic
973632116 4:52829347-52829369 TAGGCAGGTATGCAAGTTGGGGG + Intergenic
975251577 4:72185593-72185615 GAGGCATATATGCAAGTTGAAGG + Intergenic
976325567 4:83767559-83767581 TAGCCCTGTATGAAAATTTCTGG + Intergenic
976740621 4:88352910-88352932 TAGGCCTCTATGTATGATGCAGG + Intergenic
980565742 4:134537874-134537896 TATGCCTGTCTCCAAGTTTCTGG + Intergenic
981561461 4:146052948-146052970 TAGACATGTTTGCAAGCTGCCGG + Intergenic
984495120 4:180487274-180487296 TGGGCCTGCCTACAAGTTGCAGG + Intergenic
986970665 5:13332480-13332502 TAGGCATGTATGCATGTGACTGG + Intergenic
989123216 5:38025669-38025691 GAGGTCTGTATGCAGGTTACCGG - Intergenic
989966106 5:50467459-50467481 TAAGGATGTATGCAAGATGCTGG - Intergenic
994148820 5:96424368-96424390 AAGGCCTCTATGTCAGTTGCAGG + Intronic
994873157 5:105379441-105379463 CAGGCTGGTCTGCAAGTTGCTGG + Intergenic
1026525197 7:71147254-71147276 TAGGCTTTTCTGCAAGTTTCAGG + Intronic
1034161131 7:148994964-148994986 TAGGCCATTCTGCAGGTTGCTGG + Intergenic
1040080200 8:43276693-43276715 TGGACCTGGATGCAAGTTCCTGG - Intergenic
1053036534 9:34831406-34831428 TAGGCCTGGGTACAAGCTGCTGG + Intergenic
1186712372 X:12212771-12212793 TAGGCCTGGGTGAAAGGTGCAGG - Intronic
1200820916 Y:7581499-7581521 TAGGCCTGTATTCAGGCTCCTGG - Intergenic
1202239389 Y:22751243-22751265 TAGGCCTGTATTCAGGCTCCTGG + Intergenic
1202392376 Y:24385005-24385027 TAGGCCTGTATTCAGGCTCCTGG + Intergenic
1202478408 Y:25285112-25285134 TAGGCCTGTATTCAGGCTCCTGG - Intergenic