ID: 1093165065

View in Genome Browser
Species Human (GRCh38)
Location 12:15795009-15795031
Sequence TTCATGTCCTATGTTAATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 143}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093165065_1093165070 22 Left 1093165065 12:15795009-15795031 CCCAGATTAACATAGGACATGAA 0: 1
1: 0
2: 0
3: 9
4: 143
Right 1093165070 12:15795054-15795076 GCTATATACATGTATCAAGTAGG 0: 1
1: 0
2: 0
3: 10
4: 139
1093165065_1093165068 0 Left 1093165065 12:15795009-15795031 CCCAGATTAACATAGGACATGAA 0: 1
1: 0
2: 0
3: 9
4: 143
Right 1093165068 12:15795032-15795054 TCTACAAAAAGAGGAAGTCCTGG 0: 1
1: 0
2: 3
3: 19
4: 240
1093165065_1093165067 -9 Left 1093165065 12:15795009-15795031 CCCAGATTAACATAGGACATGAA 0: 1
1: 0
2: 0
3: 9
4: 143
Right 1093165067 12:15795023-15795045 GGACATGAATCTACAAAAAGAGG 0: 1
1: 0
2: 0
3: 12
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093165065 Original CRISPR TTCATGTCCTATGTTAATCT GGG (reversed) Intronic
905993533 1:42360818-42360840 TTCATGTTCTAGGTTACTCTTGG - Intergenic
907475829 1:54704752-54704774 TTCATGTCCTATAAAAATGTAGG - Intronic
908159721 1:61394547-61394569 TTCACTCCCTGTGTTAATCTGGG - Intronic
909308376 1:74112226-74112248 TTCAGGTTCTATGTTCATATAGG - Intronic
911401147 1:97377190-97377212 TTCATTTCCTGTGTTAGCCTTGG - Intronic
912849922 1:113114721-113114743 TTCATGCCCAATGCTACTCTGGG - Exonic
916918136 1:169432448-169432470 TTCATATCCTTTATTAAACTTGG - Intronic
917377103 1:174360800-174360822 TTCATCTCCTCTCTTAATATTGG + Intronic
918705382 1:187654858-187654880 TTTATGAGCTATGTAAATCTTGG - Intergenic
919367638 1:196684507-196684529 TTCATGTCCTTCTTTAATCGCGG + Intronic
921111029 1:212036775-212036797 TTTCTGTCCAAGGTTAATCTGGG - Intronic
921671063 1:217924690-217924712 TTCAAGTCGTATGTTCATTTCGG - Intergenic
1065444929 10:25788513-25788535 TTCATGTACTTTGTGAACCTGGG - Intergenic
1069067202 10:63954952-63954974 TACATGTCCTATTATTATCTAGG + Intergenic
1070998716 10:80810312-80810334 TTCATGAGCTATTTTAATTTAGG + Intergenic
1072439448 10:95440773-95440795 TTCATGGCATTTCTTAATCTGGG - Intronic
1078586548 11:12596145-12596167 TTGATGTCCTTTGTGAATTTTGG - Intergenic
1080943045 11:36940860-36940882 TTCTTGTCCTATGGCAACCTTGG + Intergenic
1083230921 11:61318531-61318553 TTCATGTCCTTTGCTAGTTTGGG + Intronic
1083405261 11:62452580-62452602 TTCATGCCATATTTTTATCTTGG + Intronic
1088027482 11:105203750-105203772 TTCATTTGCAATGTTAATATGGG + Intergenic
1088867162 11:113859170-113859192 TTCCTGTCATATGTTAAGCCAGG - Intronic
1089297077 11:117476094-117476116 TTAATGAAATATGTTAATCTGGG - Intronic
1091127322 11:133112154-133112176 TTTATTCCCTATATTAATCTTGG + Intronic
1093165065 12:15795009-15795031 TTCATGTCCTATGTTAATCTGGG - Intronic
1093485703 12:19649766-19649788 TTCATTTCCAAAGTTCATCTAGG - Intronic
1094558879 12:31530902-31530924 TTCATCTCCTATTTTACTCTAGG + Intronic
1097512949 12:60566284-60566306 ATCATGTCTTAGGTTTATCTTGG - Intergenic
1098512735 12:71337493-71337515 TTTTTGGCCTATGTTAATCAAGG - Intronic
1098732194 12:74050941-74050963 TTAATGTCTGCTGTTAATCTGGG + Intergenic
1098746388 12:74242490-74242512 TTTATTTCCAATGTTAATCAAGG - Intergenic
1099052728 12:77800872-77800894 TTCAAGTCCTTTATTCATCTAGG + Intergenic
1099445196 12:82743616-82743638 TCCATGTCCAATTTTGATCTTGG + Intronic
1101708365 12:107242054-107242076 TTAATGTGCTATGTTAACGTAGG + Intergenic
1105672771 13:22638619-22638641 AACACGTCCTATGTTCATCTGGG - Intergenic
1107521074 13:41182214-41182236 TTCTTGTGCTATCTTAATCAGGG - Intergenic
1108995035 13:56719813-56719835 TTTATATCTTATGTTAAACTTGG + Intergenic
1110043537 13:70797812-70797834 TTCATGTCCTCTTATAATATGGG - Intergenic
1111260320 13:85730438-85730460 TTTTTGTCCTATAATAATCTGGG - Intergenic
1111342663 13:86908588-86908610 TTCATATCATTTCTTAATCTGGG - Intergenic
1111906119 13:94258087-94258109 ATGATTGCCTATGTTAATCTTGG - Intronic
1112498685 13:99925611-99925633 TTCATGGCCCATGTTCAGCTAGG + Intergenic
1113724266 13:112586931-112586953 TGGATGTTCTATGATAATCTTGG - Intronic
1113883430 13:113642807-113642829 TTCATGTCTTTTATTAAACTTGG - Intergenic
1114232663 14:20798383-20798405 TTCATGTTCTCAGTTACTCTTGG - Intergenic
1115127469 14:30013556-30013578 TTCGTATCCTAGGTGAATCTGGG + Intronic
1116230844 14:42215029-42215051 TTCTTATCCCATGATAATCTTGG + Intergenic
1116242183 14:42359077-42359099 TCCATATATTATGTTAATCTGGG + Intergenic
1117709202 14:58506748-58506770 TTGATCTTTTATGTTAATCTAGG - Intronic
1121539384 14:94713567-94713589 TTCACGTCGTATGTTATTGTTGG + Intergenic
1124558338 15:30747933-30747955 TTCATGTCCCATGATGATATGGG - Intronic
1124661123 15:31551850-31551872 TTCATGTCCTTTGCTCCTCTGGG + Intronic
1124672922 15:31657713-31657735 TTCATGTCCCATGATGATATGGG + Intronic
1126554914 15:49975824-49975846 TTCATGTCTTATTTTATTCATGG + Intronic
1127058467 15:55156848-55156870 TTCATGTCCTTTGCTTACCTTGG - Intergenic
1127597965 15:60505924-60505946 ATCATTTCCTATGTCTATCTAGG - Intronic
1127744485 15:61952634-61952656 TTGATGTTATATGTTAAACTTGG - Intronic
1142527222 17:552104-552126 TTCATGTCCTGGTTTTATCTGGG + Intronic
1149162226 17:53708033-53708055 TTCAGAGCCTAAGTTAATCTAGG + Intergenic
1151057460 17:71049710-71049732 ATCATGTCCCATGTTTGTCTTGG + Intergenic
1153225128 18:2894098-2894120 TTCATGGCCTCTGTGAACCTTGG + Intronic
1155326202 18:24667371-24667393 TTCCTCTCCTATGTTATTCTGGG + Intergenic
1156650641 18:39222733-39222755 TTCATGTGTGATGTTAATGTTGG - Intergenic
1158710414 18:59832171-59832193 TTATTGTCCTATGTTCATCTAGG - Intergenic
1167489705 19:49785185-49785207 TTCCTGGCCTATTTGAATCTGGG - Intronic
929727688 2:44447537-44447559 TTCATGTTGCATGTTTATCTTGG + Intronic
932332029 2:70903295-70903317 TTGCTGTCCTATGTCAATGTTGG + Intronic
936653626 2:114458270-114458292 TTCAAATTCTATATTAATCTAGG + Intronic
940665949 2:156609880-156609902 TTCATTTCCTCTGATACTCTTGG - Intronic
941351820 2:164447445-164447467 ATCCTGCCCTATTTTAATCTTGG + Intergenic
942688017 2:178554538-178554560 TTCATTTCCTTTGATAATTTTGG + Exonic
943244544 2:185429835-185429857 TACATGTGCTATTATAATCTTGG - Intergenic
943473180 2:188320721-188320743 TTCATCTTCTATGTGAATATGGG + Intronic
943965311 2:194325542-194325564 TTAAAGTCCCATGTTAATTTGGG - Intergenic
1170362955 20:15567480-15567502 TTTATATACTATGATAATCTGGG - Intronic
1170437256 20:16342991-16343013 TTCATGCCCAATTTTAATTTGGG - Intronic
1172971698 20:38878252-38878274 TTCATGTCCTATGTAATACAGGG + Intronic
1173988566 20:47281937-47281959 TTCCTGTGGTATGTTAAGCTTGG - Intronic
1176816058 21:13604364-13604386 TTGATGTTCTCTATTAATCTAGG - Intergenic
1177001460 21:15618706-15618728 TCCATGTACTTTGTTAATCGGGG + Intergenic
1179334565 21:40438320-40438342 ATCATGTGTTATGTTAATCTTGG + Intronic
1181624438 22:24113783-24113805 TTGATGTCCTGTGGCAATCTGGG + Intronic
1183070723 22:35394221-35394243 TTCATGGGCTTTGTTATTCTTGG + Intergenic
952578098 3:34799014-34799036 CAGATGTCCTATGTTAGTCTGGG + Intergenic
955299992 3:57769031-57769053 GTCATATCCTATGTTAGTCAAGG - Intronic
957251648 3:77779287-77779309 TTGATGTTCTCTATTAATCTAGG + Intergenic
957812363 3:85241277-85241299 TGAATGTCCTATCATAATCTAGG - Intronic
957901560 3:86500398-86500420 TTCATTTCCTATCTTGGTCTTGG + Intergenic
960355558 3:116648535-116648557 TGAATGTCCTATATTAATCAAGG - Intronic
961338119 3:126197341-126197363 TTCATTGGCTAAGTTAATCTAGG - Intronic
963341785 3:144044424-144044446 TTAATGTCGTATTTTTATCTTGG - Intronic
965141298 3:164839153-164839175 TTCATTTCATTTGTTAATATAGG + Intergenic
973032637 4:45362645-45362667 GTCATGTCCTATGTGAATGGAGG - Intergenic
975333057 4:73141453-73141475 TTCATGTAAAATGTTAAGCTGGG - Intronic
975402731 4:73956279-73956301 TTACTTTCCTATGTTAATTTTGG + Intergenic
976654979 4:87479093-87479115 TTCATATCCTACCTTAACCTGGG - Intronic
977117560 4:93049915-93049937 TTCTTTTCCTATGTTATTATTGG + Intronic
978287987 4:107100464-107100486 TTCATGTTCTATTTTATTTTGGG - Intronic
978608006 4:110503805-110503827 TTCATGTCCTTTGTTTCTCAGGG + Intronic
978831697 4:113093726-113093748 TTTATGTCATATGTTCATCTAGG + Intronic
979684973 4:123501927-123501949 TTCCTGTTCTTTGTTATTCTTGG - Intergenic
981659858 4:147153989-147154011 TTCATATAATATGTTAATCTAGG - Intergenic
983683102 4:170374841-170374863 TGCATGGCCTTTGTTAATCGGGG - Intergenic
983797103 4:171877685-171877707 TTTAAGTACTATGTTAATATTGG + Intronic
988907566 5:35804871-35804893 TACAGGTTCTATGTTTATCTTGG + Intronic
988945565 5:36193707-36193729 TTAATGTACAAAGTTAATCTAGG - Intronic
989182072 5:38588145-38588167 TCCATGTCACATGTTAATGTTGG - Intronic
991291440 5:65036975-65036997 TTCATGTCCTCTGCTTATCCTGG - Intergenic
991554494 5:67880352-67880374 ATAATGTCCTATTTGAATCTTGG + Intergenic
992202847 5:74401198-74401220 TTCATGTGTTATTTTAACCTGGG + Intergenic
993942921 5:94082974-94082996 TTCAAGTCCTTTGTTAATTTAGG - Intronic
996018083 5:118563249-118563271 ATAATCTCCTATGTTAATCTAGG + Intergenic
997992828 5:138560300-138560322 TTCATGACCCTTGTAAATCTGGG + Intronic
1001000176 5:167998338-167998360 TTCTTGTCCTAGGTTAACATTGG + Intronic
1002652609 5:180712243-180712265 TTCCTTTCCTCTGTTAATTTTGG - Intergenic
1003759770 6:9164437-9164459 TTCATGCAATATGATAATCTAGG - Intergenic
1005309340 6:24544444-24544466 ATCATGGACTATTTTAATCTTGG - Exonic
1007907623 6:45478253-45478275 TTCATGAACTATGCTAAACTAGG - Intronic
1008330090 6:50234864-50234886 CTCTTGTCCAGTGTTAATCTGGG - Intergenic
1009380717 6:63025437-63025459 ATCATGTCCTATGATAATACAGG - Intergenic
1013342068 6:109224625-109224647 GTCCTGTCCTATGTAATTCTGGG + Intergenic
1013370945 6:109470519-109470541 GTCATGCCCCATGTTATTCTGGG - Intronic
1014482217 6:121952950-121952972 TTCATTTCCTAATTTAAACTAGG - Intergenic
1016269482 6:142272269-142272291 TTCAGGTCCTATGTGTATCCAGG - Intergenic
1019803546 7:3105964-3105986 TGCATGGCCTCTGTTGATCTAGG - Intergenic
1020347065 7:7176961-7176983 CTCATTTCCTATGTTAAATTAGG - Intronic
1024595495 7:50931852-50931874 TTGATGTCCTTTGTCAATTTTGG + Intergenic
1024815013 7:53258019-53258041 TTGATGTCCTTTGTCAATTTTGG + Intergenic
1028341335 7:89723616-89723638 TGCATGTCCTATGTTCACTTTGG - Intergenic
1029672750 7:102045244-102045266 TTCATTTCCTATGTTATGCAAGG - Intronic
1030393528 7:108956986-108957008 TTCATGTCCAATGATAATAAAGG - Intergenic
1033578278 7:142707839-142707861 TTCAAGACCTATGTTACACTTGG + Intergenic
1037125562 8:15344021-15344043 TTTATCTCCCATTTTAATCTGGG + Intergenic
1037404571 8:18528090-18528112 TGCCTGTCCTATGGTAATCAAGG + Exonic
1040590084 8:48783576-48783598 TTCATTTCCTAAGTCAAGCTAGG + Intergenic
1042177847 8:66055064-66055086 TTCAGGTCATATGTTAATTAAGG + Intronic
1042385409 8:68168164-68168186 TACATGTACTACGTTTATCTTGG + Intronic
1042470296 8:69179625-69179647 TACATGTAATATGTTATTCTGGG + Intergenic
1043932004 8:86101997-86102019 TTCATGTCCTCTGTTAGTTGAGG + Intronic
1046614190 8:116457883-116457905 CTCATGACCTACATTAATCTAGG - Intergenic
1046994843 8:120506941-120506963 TTGATGTCCTATGCTACTCAGGG + Intronic
1047486830 8:125338940-125338962 TTCATGTCAACTGTAAATCTAGG - Intronic
1047826589 8:128582534-128582556 CTCATTTCCTATGTAAGTCTGGG + Intergenic
1058113297 9:101055265-101055287 TTCCTCTCCTATGCTAATCCAGG + Intronic
1059626687 9:116074655-116074677 ATAATGTCCTATGCAAATCTTGG + Intergenic
1060395364 9:123312795-123312817 TTCCTGTCCTCTGATGATCTTGG - Intergenic
1203531300 Un_GL000213v1:145101-145123 TTGATGTTCTCTATTAATCTAGG + Intergenic
1186546262 X:10452956-10452978 TTAATGTGCTGTATTAATCTGGG - Intronic
1187939571 X:24368862-24368884 CTCATGGCCTATGGTCATCTGGG + Intergenic
1190652172 X:52577949-52577971 TTCATGCCCAATGCCAATCTGGG + Intergenic
1194902335 X:99528202-99528224 TTCATTTTGTATGTTATTCTAGG - Intergenic
1195740597 X:108061213-108061235 AGCATGTTGTATGTTAATCTAGG + Intronic
1196224371 X:113148381-113148403 TTAATGGCATATGATAATCTGGG + Intergenic