ID: 1093165065

View in Genome Browser
Species Human (GRCh38)
Location 12:15795009-15795031
Sequence TTCATGTCCTATGTTAATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 143}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093165065_1093165067 -9 Left 1093165065 12:15795009-15795031 CCCAGATTAACATAGGACATGAA 0: 1
1: 0
2: 0
3: 9
4: 143
Right 1093165067 12:15795023-15795045 GGACATGAATCTACAAAAAGAGG 0: 1
1: 0
2: 0
3: 12
4: 136
1093165065_1093165068 0 Left 1093165065 12:15795009-15795031 CCCAGATTAACATAGGACATGAA 0: 1
1: 0
2: 0
3: 9
4: 143
Right 1093165068 12:15795032-15795054 TCTACAAAAAGAGGAAGTCCTGG 0: 1
1: 0
2: 3
3: 19
4: 240
1093165065_1093165070 22 Left 1093165065 12:15795009-15795031 CCCAGATTAACATAGGACATGAA 0: 1
1: 0
2: 0
3: 9
4: 143
Right 1093165070 12:15795054-15795076 GCTATATACATGTATCAAGTAGG 0: 1
1: 0
2: 0
3: 10
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093165065 Original CRISPR TTCATGTCCTATGTTAATCT GGG (reversed) Intronic