ID: 1093165778

View in Genome Browser
Species Human (GRCh38)
Location 12:15803472-15803494
Sequence AAGTACCATGATGCTTCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 115}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093165777_1093165778 8 Left 1093165777 12:15803441-15803463 CCTTCATGACTCAGGTTCTGGAA 0: 1
1: 0
2: 0
3: 21
4: 193
Right 1093165778 12:15803472-15803494 AAGTACCATGATGCTTCTGCAGG 0: 1
1: 0
2: 0
3: 3
4: 115
1093165775_1093165778 14 Left 1093165775 12:15803435-15803457 CCAGATCCTTCATGACTCAGGTT 0: 1
1: 0
2: 1
3: 5
4: 166
Right 1093165778 12:15803472-15803494 AAGTACCATGATGCTTCTGCAGG 0: 1
1: 0
2: 0
3: 3
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093165778 Original CRISPR AAGTACCATGATGCTTCTGC AGG Intronic
900633093 1:3648999-3649021 ATGTATCATGATGCTTTTTCAGG - Intronic
906832680 1:49049999-49050021 AAGGACCTTTATGCTTATGCAGG + Intronic
908091492 1:60690293-60690315 AAGTTCCATGATACATGTGCAGG - Intergenic
911718574 1:101165027-101165049 AAGTTCCATCATGATTCTGTTGG + Intergenic
911748201 1:101464518-101464540 AATTTCCATGTTGCATCTGCAGG - Intergenic
914977483 1:152379625-152379647 AAGTAACATGATGTCTCTGCAGG + Intergenic
921094179 1:211872993-211873015 AAGTTCCATGATGCTTCCATGGG + Intergenic
1066151297 10:32621983-32622005 AAGTACAATGGTGCTTGTGATGG - Intronic
1066545917 10:36500403-36500425 TAGTCCCATGCTGCTTCTGTTGG + Intergenic
1066957532 10:42187216-42187238 CGGTACCAGGATGGTTCTGCAGG + Intergenic
1071173968 10:82901580-82901602 AAGTCCCATTATTCTTCTGGAGG - Intronic
1074307757 10:112294796-112294818 AAGTAGGGAGATGCTTCTGCAGG + Intronic
1080566655 11:33515808-33515830 AAGTAACGTGATGCATCTGTTGG + Intergenic
1082110291 11:48266596-48266618 AGGGGCTATGATGCTTCTGCAGG + Intergenic
1085971832 11:81601217-81601239 GAGTATCATGTTGATTCTGCAGG - Intergenic
1086763813 11:90669193-90669215 AAGTCCTATGCTGCTTCTCCAGG - Intergenic
1091259174 11:134220385-134220407 AAGTACCTTGAAGCTTTTGGAGG + Intronic
1091316751 11:134619265-134619287 CAGTCCCACGCTGCTTCTGCAGG - Intergenic
1091671334 12:2454230-2454252 AAGAACCAAGAAGCTACTGCAGG - Intronic
1091905505 12:4184371-4184393 AATTCCCAGGATGTTTCTGCAGG + Intergenic
1091996854 12:5000621-5000643 AAGTTCCAGGTGGCTTCTGCTGG - Intergenic
1092753386 12:11739869-11739891 AAGTCCAATAATGCTTCTGATGG - Intronic
1093165778 12:15803472-15803494 AAGTACCATGATGCTTCTGCAGG + Intronic
1102928920 12:116847860-116847882 AAGTTCCAGGATGCATGTGCAGG + Intronic
1108440653 13:50449664-50449686 AGTTTCCATGAGGCTTCTGCAGG + Intronic
1117476837 14:56104087-56104109 AAGAACCATGCTGCTTGTTCAGG - Intergenic
1118806439 14:69241229-69241251 TAATCCCAGGATGCTTCTGCTGG + Exonic
1120026758 14:79594824-79594846 AAGTACCTTGGTGCTTCTTTTGG + Intronic
1127646811 15:60966907-60966929 AACTGCCATGATGTTTCTGCAGG + Intronic
1127960927 15:63890161-63890183 ACATAGCATGATGCTTCTGAAGG - Intergenic
1129362162 15:75030654-75030676 AGGGACAATGATGCTCCTGCAGG - Intronic
1135055728 16:19230593-19230615 AAGTACCTGGATGCTGATGCTGG + Intronic
1135992948 16:27228725-27228747 GAGTACCATGATGGATCTGGAGG - Intronic
1135992984 16:27228837-27228859 GGGTACCATGATGCATCTGGAGG - Intronic
1137059421 16:35774721-35774743 AAGTACCATTTTGATTCAGCAGG - Intergenic
1138916540 16:61471538-61471560 TAGTACCTTGATACTGCTGCTGG - Intergenic
1140158862 16:72463328-72463350 AATTACCATGATGTTTCACCTGG - Intergenic
1141489501 16:84362583-84362605 CAGTGCCTTGTTGCTTCTGCTGG + Intergenic
1141706227 16:85666331-85666353 CATTACCTTTATGCTTCTGCAGG - Exonic
1142703173 17:1676827-1676849 AAGCACCATGTTGCTTAGGCTGG - Intronic
1145278366 17:21450438-21450460 AAGTACCGTGATGTTGGTGCTGG + Intergenic
1145401089 17:22533598-22533620 AAGTACCGTGATGTTGGTGCTGG - Intergenic
1151390414 17:73783326-73783348 AAGTTCCCAGATGCTGCTGCTGG + Intergenic
1152582467 17:81172438-81172460 AAGAACCCTGAAGCTTCTCCTGG + Intergenic
1156241601 18:35259879-35259901 AAGTTCCAGGATGCATGTGCAGG + Intronic
1157101235 18:44731889-44731911 AATTACTATGATGCTTCTTAGGG - Intronic
1157760668 18:50262138-50262160 AAATAGCATTATGCTTCTGATGG + Exonic
1159023741 18:63164498-63164520 AAGTACCATGAGGCTTTTAGGGG + Intronic
1161456527 19:4372443-4372465 AAGGACTCTGCTGCTTCTGCAGG - Intronic
1162043840 19:7985896-7985918 AAGTATCCTGATGCTGCTGCTGG + Intronic
1162202675 19:9032473-9032495 AAGTGCCATACAGCTTCTGCTGG - Intergenic
1164574105 19:29395547-29395569 AACTCACAAGATGCTTCTGCAGG + Intergenic
1168216452 19:54929648-54929670 CAGCAGCATGCTGCTTCTGCTGG - Intronic
925704292 2:6669192-6669214 AAGCTCCATGAAGCTTCTCCCGG - Intergenic
928417285 2:31106327-31106349 AACTAAAATTATGCTTCTGCTGG + Intronic
930410068 2:51014135-51014157 AAGTGCAGTGATGCTGCTGCTGG + Intronic
932895948 2:75639943-75639965 AAATCCCATAATCCTTCTGCTGG + Intergenic
933623229 2:84568696-84568718 AAGTTCCAGGATGCATGTGCAGG - Intronic
941046280 2:160679316-160679338 AAGTTCCAGGATGCATGTGCAGG + Intergenic
941277190 2:163504025-163504047 AAGTCCCAAGATGCATGTGCAGG - Intergenic
941748890 2:169114958-169114980 ACATACCATGATGCTCCTTCTGG - Intergenic
944002634 2:194859022-194859044 AAGTTCCAGGATACTTGTGCAGG + Intergenic
945280630 2:208032180-208032202 AAGTACCATAATACTTGTGGAGG - Intergenic
1169793326 20:9435145-9435167 AATTATCATGATTATTCTGCAGG + Intronic
1170161680 20:13319807-13319829 AGGTGCCCTGATGCTGCTGCAGG - Intergenic
1171263254 20:23750830-23750852 GAGTACCCTGCTGCTCCTGCTGG - Exonic
1173281459 20:41631919-41631941 AAGTTCCTAGATGCTGCTGCTGG - Intergenic
1173899464 20:46576518-46576540 CAGGACAATGATGCATCTGCAGG + Intronic
1175379609 20:58553676-58553698 GTGAACCATGATGCTTCTTCCGG - Intergenic
949539695 3:5022589-5022611 AAGAATCATGATGTTTATGCAGG - Intergenic
950480062 3:13238489-13238511 AAGTGCCATGAAGGTTCTGTCGG - Intergenic
951525396 3:23648149-23648171 AAGCACCAGGAAGCTTCTGTTGG - Intergenic
951939887 3:28065944-28065966 AAGTTCTAGGATGCTTGTGCAGG + Intergenic
960147037 3:114214500-114214522 AAGTTACAAGATGCTTCTGGGGG + Intergenic
960927574 3:122810598-122810620 AAGTTCCAGGATGCATGTGCAGG + Intronic
963250096 3:143095372-143095394 AAGACCCCTGGTGCTTCTGCAGG + Intergenic
967122885 3:186399449-186399471 AAAGACCATGAGGCTTCTGGGGG - Intergenic
970319343 4:14860488-14860510 AAGTTCCAGGATGCATGTGCAGG - Intergenic
972985688 4:44761643-44761665 AATTCCCATGATCCTTGTGCTGG - Intergenic
975655239 4:76634957-76634979 AAATACAATGATGCTATTGCTGG - Intronic
976399958 4:84596367-84596389 TAGGACCATGTTCCTTCTGCAGG + Intronic
978028956 4:103914581-103914603 AAGTTCCAGGATGCATGTGCAGG - Intergenic
979036124 4:115720711-115720733 AAATTCCCTCATGCTTCTGCAGG - Intergenic
980900210 4:138897760-138897782 AAGTATCCTGATGCTGTTGCTGG - Intergenic
981543027 4:145865564-145865586 AAATTTCATGATGATTCTGCTGG + Intronic
982245097 4:153343572-153343594 ATGTCCCCTGTTGCTTCTGCTGG - Intergenic
985230613 4:187811962-187811984 AAGTACCATGATTCATTTTCAGG - Intergenic
987776786 5:22377000-22377022 AGGTCCCATGATGCCTCTGGTGG - Intronic
988972394 5:36482630-36482652 AAATTTCATGATGCTTCTGGGGG - Intergenic
992073347 5:73168957-73168979 AAAATCCATGCTGCTTCTGCAGG - Intergenic
995502235 5:112820063-112820085 AACTCCCATGCTGCTCCTGCGGG - Intronic
998478879 5:142444957-142444979 AAGTTCCAGGATACTTGTGCAGG + Intergenic
1000163553 5:158625081-158625103 AAGTACCATGGTGCTACTTAAGG + Intergenic
1001906474 5:175478020-175478042 AAATACCATGATTCCTCTCCTGG + Intronic
1004794653 6:19067730-19067752 AAGAGCCATGATGCTGATGCAGG - Intergenic
1006143906 6:31946877-31946899 AGGTAAGATGCTGCTTCTGCGGG + Intronic
1006283502 6:33076035-33076057 CAGCTCCATGATGGTTCTGCAGG + Exonic
1008713961 6:54265668-54265690 AAGTGCCATGATGGTTTTGAGGG - Intronic
1010664664 6:78614539-78614561 AAGTTCCAGGATGCATGTGCAGG - Intergenic
1013484269 6:110580923-110580945 AAGTTCCAGGATGCATGTGCAGG - Intergenic
1019054922 6:169216382-169216404 AAGTTGCATGATCTTTCTGCAGG - Exonic
1028082630 7:86598412-86598434 AAGTACCTGGATGTTTCTGTTGG - Intergenic
1028462270 7:91107896-91107918 AAGTCTAATGAAGCTTCTGCAGG + Intronic
1030856952 7:114570533-114570555 ATGTACCATGATACTGCTGTAGG - Intronic
1031147571 7:118013933-118013955 AAGTAGAATGGTGCTTCTGGTGG - Intergenic
1031552365 7:123130693-123130715 AAGTTCCATGATACATGTGCAGG - Intronic
1035826977 8:2655164-2655186 CAGTAGCCTGATGTTTCTGCTGG - Intergenic
1039716611 8:40116544-40116566 ATTTCCCATGATGCTTCTCCCGG - Intergenic
1040397770 8:47015725-47015747 CCATACCATGATGCTGCTGCTGG + Intergenic
1041897799 8:62946297-62946319 AGGCACCATGATGGGTCTGCTGG - Intronic
1042843122 8:73144596-73144618 AAGTCCCATGATACATGTGCAGG - Intergenic
1043134357 8:76502575-76502597 CATTTCCATCATGCTTCTGCTGG - Intergenic
1046797089 8:118384996-118385018 GAGTACCATGTTCCTGCTGCGGG - Intronic
1048766855 8:137854187-137854209 AAGTACCAAGATGCTGGTGAAGG + Intergenic
1052019907 9:23513822-23513844 AAATGCTATGATTCTTCTGCAGG + Intergenic
1056988676 9:91389252-91389274 GAATACCATGATGCTACGGCTGG - Intergenic
1193260658 X:79403292-79403314 CTGTACCATGATTCTGCTGCTGG - Intergenic
1197014250 X:121604761-121604783 AAGTACTATGATGCTTCCTTGGG + Intergenic
1197087864 X:122500371-122500393 ATGTACCATGATGAGGCTGCGGG + Intergenic