ID: 1093167507

View in Genome Browser
Species Human (GRCh38)
Location 12:15821938-15821960
Sequence TGTATGGGCAACTATGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 106}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093167507_1093167513 27 Left 1093167507 12:15821938-15821960 CCCTCTCCATAGTTGCCCATACA 0: 1
1: 0
2: 0
3: 5
4: 106
Right 1093167513 12:15821988-15822010 TAAAAAAAAAAAAAAAAATCAGG 0: 28
1: 1007
2: 9971
3: 67988
4: 91635
1093167507_1093167512 2 Left 1093167507 12:15821938-15821960 CCCTCTCCATAGTTGCCCATACA 0: 1
1: 0
2: 0
3: 5
4: 106
Right 1093167512 12:15821963-15821985 CTGATCTCACTTCTTCTGTAAGG 0: 1
1: 0
2: 0
3: 10
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093167507 Original CRISPR TGTATGGGCAACTATGGAGA GGG (reversed) Intronic
901151135 1:7102584-7102606 TGTATGCGCAAGGATGGAGGAGG + Intronic
902173316 1:14630384-14630406 TGTATACTCAACTATGAAGATGG + Intronic
907927482 1:58968077-58968099 GGGAGAGGCAACTATGGAGAAGG + Intergenic
914758019 1:150577114-150577136 TGTTTGGGAAGCTATGGAGGAGG - Exonic
915002046 1:152602661-152602683 TTGAGGGGCAAATATGGAGAAGG - Intergenic
920855347 1:209657139-209657161 TCTATGGGCACAGATGGAGAAGG + Intergenic
921716607 1:218423407-218423429 TGCATGGGGAACTAGGGAAAGGG + Intronic
1063306716 10:4909449-4909471 TGTATGGGCAAATAGGAAAAAGG - Intergenic
1064464814 10:15568317-15568339 TGTTTGGGCAACAAGTGAGATGG + Intronic
1071684191 10:87737209-87737231 TGTGTGGGACACTATGAAGATGG + Intronic
1081286715 11:41279497-41279519 GGGATGGGTAACTATGGAGCTGG - Intronic
1085318705 11:75561755-75561777 TGAATGTACAAGTATGGAGAAGG + Intergenic
1086861110 11:91925962-91925984 GGTATGGGGAGGTATGGAGAGGG - Intergenic
1087849155 11:103008967-103008989 TGTAGGGGCAACGAAGGAGAAGG - Intergenic
1088927526 11:114317408-114317430 TGAATAAGCAACTATGAAGAAGG - Intergenic
1093167507 12:15821938-15821960 TGTATGGGCAACTATGGAGAGGG - Intronic
1093535175 12:20214646-20214668 TGCATGGCCAACTCTGAAGATGG - Intergenic
1096272586 12:50177980-50178002 TCTAAGGGCAACTATGATGAAGG - Exonic
1097333642 12:58358476-58358498 GGTATGGGCTACAATAGAGATGG + Intergenic
1099169545 12:79347431-79347453 TCTATGGGGAACTCTGGAGCTGG - Intronic
1105604432 13:21915129-21915151 TGCATGGGCAGCCATGGAGGAGG - Intergenic
1106839349 13:33669982-33670004 TTTGTGGGTAAATATGGAGAAGG - Intergenic
1110601610 13:77380975-77380997 GGTATAGGCAACTTTGGACAGGG - Intergenic
1110748949 13:79090402-79090424 TGGATGGGCAGTGATGGAGAGGG - Intergenic
1110749434 13:79095544-79095566 TGGATGGGCAGTGATGGAGAGGG - Intergenic
1113825922 13:113253017-113253039 TGAATGGGGAGCTATTGAGATGG + Intronic
1115792976 14:36900358-36900380 TGTATGGAGGACTATCGAGAAGG + Intronic
1119564793 14:75619341-75619363 TGTATGGGAAAGTAAGGAGAGGG - Intronic
1122150647 14:99724454-99724476 TGTAAGGGGATCTAAGGAGATGG - Intronic
1123108597 14:105854805-105854827 TGTCTGGGCAACTGGGGAAAAGG - Intergenic
1127727952 15:61769019-61769041 TGTATGGAAAACTGTGGAGTGGG - Intergenic
1128352069 15:66897693-66897715 GGAATGGGGAACTGTGGAGAGGG - Intergenic
1128783500 15:70378426-70378448 TGTCTGGGCAACCAAGGAGATGG - Intergenic
1131602764 15:93866297-93866319 TGTCTGGACAGCTAGGGAGAAGG + Intergenic
1133021973 16:2970675-2970697 TGTCTGGACACTTATGGAGAGGG + Intronic
1133883565 16:9805536-9805558 TGTTTGGGCAACTGTGGAACAGG + Intronic
1138789925 16:59891656-59891678 TGTTTCTGCAACTATTGAGATGG + Intergenic
1139435156 16:66932681-66932703 TCTATGGGCAAGACTGGAGATGG - Intronic
1140294589 16:73695915-73695937 TGTAGGAGCAACAAAGGAGAGGG + Intergenic
1140335127 16:74097891-74097913 TGTATGGCTTACTCTGGAGAAGG - Intergenic
1144334570 17:14257220-14257242 TGGATGGACAAGTCTGGAGATGG - Intergenic
1147570449 17:41567463-41567485 AGTGGGGGCAACTATGGAGGAGG - Exonic
1149361455 17:55899808-55899830 TGCATGGGCTACTATGGGAATGG - Intergenic
1153752039 18:8242382-8242404 TGTAAGTGCAGCTATGGAGATGG + Intronic
1157303642 18:46499927-46499949 TGTCCGGGAAACTATGGAGTAGG + Intronic
1163757420 19:19114552-19114574 TGTATGGGCCACCATGGTAATGG - Intergenic
1166912965 19:46173956-46173978 TGTCTGGGCAAAGATGGAGCTGG + Intergenic
926607826 2:14915119-14915141 TGGAGGGGCAATAATGGAGACGG + Intergenic
927070403 2:19522966-19522988 TGTTTGGGCACCTGTGGGGATGG + Intergenic
929567198 2:42996660-42996682 AGCATGGGCAACTCTGGAGTAGG - Intergenic
932484585 2:72076047-72076069 TTTATGGGCAGCTTGGGAGAGGG + Intergenic
933270463 2:80227523-80227545 TGTCTGTGCTTCTATGGAGAAGG - Intronic
933800943 2:85960002-85960024 TGTCACGGGAACTATGGAGAAGG - Intergenic
934524724 2:95044613-95044635 TCTATGGACAACTGTGGACAAGG + Intronic
942946543 2:181680288-181680310 CTTATGGGCAATTATGGAGGGGG + Intronic
1168903728 20:1387717-1387739 TGTATGCCCAACTATTCAGAAGG + Intronic
1172028157 20:31963500-31963522 TGAATGGGGAACTGGGGAGAAGG - Intergenic
1177830002 21:26127514-26127536 TGTATCTGCAACTATGAACAGGG + Intronic
1183791222 22:40071753-40071775 TGTATGTTAAATTATGGAGATGG + Intronic
951509345 3:23484512-23484534 TGTCTGGGCAACAAGAGAGAAGG - Intronic
953202268 3:40788056-40788078 TCTTTGGGAAACTATTGAGAAGG + Intergenic
955064673 3:55524172-55524194 TGTATGGGCGAGTATAGAGGGGG - Intronic
959001850 3:100973333-100973355 TCTATGGGGAAATATGGAGTTGG - Intronic
959830436 3:110855343-110855365 TCTATTGTCAAGTATGGAGAAGG - Intergenic
960742510 3:120850679-120850701 TCTATGGGCAACCAGGAAGAAGG + Intergenic
960946498 3:122970389-122970411 TGAATGAGAAACTCTGGAGAAGG - Intronic
961388079 3:126535821-126535843 GGTTTGGGCAACAGTGGAGATGG - Intronic
962086827 3:132200039-132200061 TGTACGGGCCACTGTGCAGAGGG + Intronic
964864663 3:161243392-161243414 TGAAAGGGAAACTATGGATAAGG + Intronic
967499430 3:190180201-190180223 TGTTTGGTCAATTATTGAGAGGG - Intergenic
971238714 4:24868189-24868211 TACATGGGCAAGTATGGAAAGGG - Intronic
974163711 4:58173020-58173042 TAAATTGGCAACTATGGAGTAGG - Intergenic
977759823 4:100720321-100720343 TGGAGGGAAAACTATGGAGAAGG + Intronic
980875596 4:138659164-138659186 TGTATGAGGAACCCTGGAGAGGG + Intergenic
982345306 4:154351303-154351325 TGTGTGGGCAAATTTGGAGGGGG + Intronic
984265538 4:177494868-177494890 AGTATTGGCAAATATGAAGAGGG + Intergenic
985836686 5:2277076-2277098 TGTCTGGGAGACTCTGGAGAAGG - Intergenic
987128740 5:14840851-14840873 TGCAAGGGCATCTATGGAAAGGG + Intronic
990957388 5:61357085-61357107 TGACTGGGAAACTCTGGAGATGG + Intronic
990996047 5:61733036-61733058 TGAAGGGGCAACGATGGGGATGG + Intronic
998216482 5:140241663-140241685 TGCATGGGCAGCTCTGGACAGGG - Intronic
1000947707 5:167441848-167441870 AGGATGTGCAACTATAGAGAAGG + Intronic
1005031710 6:21514984-21515006 TGGAAGAGCAACTGTGGAGATGG - Intergenic
1008805703 6:55424945-55424967 TGTATGGCCAATAATGGGGAAGG + Intergenic
1012193130 6:96305344-96305366 TGTATGTGCATGTAGGGAGAAGG + Intergenic
1014265571 6:119273403-119273425 GGCATGGGCAAGTATGGATATGG - Intronic
1016096016 6:140038233-140038255 TGTATGGGCAGCCATTGAGCTGG + Intergenic
1020655424 7:10923261-10923283 TGCAGGTGCTACTATGGAGAAGG - Intergenic
1020770636 7:12389126-12389148 TGTATGGGCTACTGTGCGGAAGG - Exonic
1022951762 7:35345967-35345989 TCTATGGGGAGCTTTGGAGAAGG - Intergenic
1024994482 7:55261526-55261548 GGTGTGGGAAACCATGGAGATGG - Intergenic
1029522178 7:101069997-101070019 TGAGTGGGCAACGATGGAGGCGG - Intergenic
1030172407 7:106616535-106616557 GGTATGGGTAGGTATGGAGAGGG + Intergenic
1030323020 7:108189121-108189143 TGAATGGGCAACTTTGTAGCAGG + Intronic
1030549995 7:110946156-110946178 TGAATCGGAAACTTTGGAGATGG - Intronic
1030653813 7:112144400-112144422 AGTATGGGCCATGATGGAGAAGG - Intronic
1031725419 7:125231320-125231342 TGTATAAGCAACTTTGGAAATGG - Intergenic
1032251871 7:130264666-130264688 TGTGGGGGCAACCATGGAGGTGG + Intergenic
1034855535 7:154542991-154543013 TTCATGAGCAAGTATGGAGAAGG + Intronic
1035329059 7:158084741-158084763 TGTATGGGCATCTGTGTGGATGG - Intronic
1040776495 8:51049573-51049595 TGTATAGGCAGCTGTGGACAAGG + Intergenic
1043034517 8:75179198-75179220 TGTCTGGGCACGGATGGAGAGGG - Intergenic
1043817136 8:84815002-84815024 TGTATGGAAAACAATGGAGGTGG - Intronic
1051481749 9:17569269-17569291 TGGATGAGCAACTCTGGAGGTGG - Intergenic
1052121483 9:24723241-24723263 TGTATCAGCAGCTATAGAGAAGG + Intergenic
1053192649 9:36086005-36086027 TGTATTGGCAAAGATGGAGACGG - Intronic
1053363311 9:37504929-37504951 TGTATGTGCCACTGAGGAGATGG + Intergenic
1058753796 9:108065406-108065428 TGTATGAACAACTTTGGACAAGG + Intergenic
1186864021 X:13701261-13701283 AGAATAGGCAAATATGGAGATGG - Intronic
1192597379 X:72425761-72425783 TGTAGGGGCATCTAAGGGGATGG - Intronic
1195369053 X:104155405-104155427 TGTAGGGGCAACTCTGTGGATGG + Intronic
1199712063 X:150476703-150476725 TGTTTTGACAAATATGGAGAGGG + Intronic