ID: 1093175758

View in Genome Browser
Species Human (GRCh38)
Location 12:15911511-15911533
Sequence GTCCCCGAGGGGTTTTCGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 28
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 24}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093175745_1093175758 6 Left 1093175745 12:15911482-15911504 CCTGCTGCCGCCCAGTGCCCTGG 0: 1
1: 0
2: 4
3: 37
4: 429
Right 1093175758 12:15911511-15911533 GTCCCCGAGGGGTTTTCGCTGGG 0: 1
1: 0
2: 0
3: 3
4: 24
1093175743_1093175758 26 Left 1093175743 12:15911462-15911484 CCGCCGGGACTAGCGCGGGGCCT 0: 1
1: 0
2: 0
3: 10
4: 77
Right 1093175758 12:15911511-15911533 GTCCCCGAGGGGTTTTCGCTGGG 0: 1
1: 0
2: 0
3: 3
4: 24
1093175748_1093175758 -1 Left 1093175748 12:15911489-15911511 CCGCCCAGTGCCCTGGCTGTGGG 0: 1
1: 0
2: 5
3: 60
4: 507
Right 1093175758 12:15911511-15911533 GTCCCCGAGGGGTTTTCGCTGGG 0: 1
1: 0
2: 0
3: 3
4: 24
1093175750_1093175758 -4 Left 1093175750 12:15911492-15911514 CCCAGTGCCCTGGCTGTGGGTCC 0: 1
1: 0
2: 4
3: 35
4: 350
Right 1093175758 12:15911511-15911533 GTCCCCGAGGGGTTTTCGCTGGG 0: 1
1: 0
2: 0
3: 3
4: 24
1093175744_1093175758 23 Left 1093175744 12:15911465-15911487 CCGGGACTAGCGCGGGGCCTGCT 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1093175758 12:15911511-15911533 GTCCCCGAGGGGTTTTCGCTGGG 0: 1
1: 0
2: 0
3: 3
4: 24
1093175751_1093175758 -5 Left 1093175751 12:15911493-15911515 CCAGTGCCCTGGCTGTGGGTCCC 0: 1
1: 0
2: 2
3: 42
4: 398
Right 1093175758 12:15911511-15911533 GTCCCCGAGGGGTTTTCGCTGGG 0: 1
1: 0
2: 0
3: 3
4: 24

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093175758 Original CRISPR GTCCCCGAGGGGTTTTCGCT GGG Intronic
907523499 1:55040155-55040177 GTCGCCGAGGGCTCTTCGCTTGG + Intronic
919790240 1:201285854-201285876 GTCCCCCAGGGGGCTTCACTGGG + Intronic
1073763156 10:106652459-106652481 GCCCCCGCGGGGCTTTCCCTGGG + Exonic
1081021376 11:37951804-37951826 TTCCCCCAGGGGTTTCCACTTGG - Intergenic
1093175758 12:15911511-15911533 GTCCCCGAGGGGTTTTCGCTGGG + Intronic
1102939557 12:116927512-116927534 GTCACTAAGGGGTTTTCACTGGG - Intronic
1116499661 14:45605374-45605396 TTCCCTGAGGGCTTTTCACTGGG + Intergenic
1130789814 15:87142132-87142154 TTCCCTGAGGGGTTTTGGATGGG + Intergenic
1139233228 16:65307508-65307530 GTCCCCGATGGGTGTGCGCCCGG - Intergenic
1140784256 16:78324980-78325002 GGCCCTGAGTGGTTTTCTCTGGG - Intronic
1141205650 16:81931492-81931514 TTCCCTGAGGGGCTTTCACTTGG - Exonic
1141840658 16:86572201-86572223 GTCCCTGGCGGGTTTTGGCTGGG + Intergenic
1151495270 17:74454697-74454719 CTCCCCGAGGGTTTTTCGGTGGG + Intergenic
1160017514 18:75155783-75155805 GTCCGCGAGGGGGTCTCGCATGG + Intergenic
929575172 2:43047077-43047099 GTTCCCAATGGGTTTTCACTGGG - Intergenic
1171359526 20:24577355-24577377 GTCCCTCAGGGGTTTTCCGTGGG - Intronic
1184932687 22:47692912-47692934 GTCCCAGAGGGGGTGTCTCTGGG - Intergenic
953389631 3:42526816-42526838 GGCCCCGAGGGTGTCTCGCTTGG - Intronic
1005618658 6:27600076-27600098 ATCCCCGTCGGGTTTTAGCTGGG + Intergenic
1018454602 6:163940806-163940828 GTCCCAAAAAGGTTTTCGCTGGG - Intergenic
1030409574 7:109158520-109158542 GTCTCTGAGGGGTTTTTGTTTGG + Intergenic
1036267024 8:7278788-7278810 ATCCCTGAGGGGTTTTTGCGGGG + Intergenic
1036268327 8:7286410-7286432 ATCCCTGAGGGGTTTTTGCGGGG + Intergenic
1036269632 8:7294032-7294054 ATCCCTGAGGGGTTTTTGCGGGG + Intergenic
1041451726 8:58013085-58013107 GCCCCTGATGGGTTTTCTCTAGG + Intronic
1043599376 8:81919130-81919152 GTGCCCAAGGGGTTTCAGCTTGG - Intergenic
1045222670 8:100213642-100213664 GTCCCCGCCGGGTTTTCCCTTGG + Intronic
1045484700 8:102622006-102622028 GTCCCCGGGGGGTTCTCTTTGGG - Intergenic