ID: 1093176208

View in Genome Browser
Species Human (GRCh38)
Location 12:15916135-15916157
Sequence CAATTTATCCTGAGGGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 226}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093176204_1093176208 15 Left 1093176204 12:15916097-15916119 CCACATCTTAACCATTGCAGTTT 0: 1
1: 0
2: 0
3: 12
4: 194
Right 1093176208 12:15916135-15916157 CAATTTATCCTGAGGGAGAATGG 0: 1
1: 0
2: 1
3: 23
4: 226
1093176205_1093176208 4 Left 1093176205 12:15916108-15916130 CCATTGCAGTTTGTTTCAGAGAA 0: 1
1: 0
2: 4
3: 23
4: 238
Right 1093176208 12:15916135-15916157 CAATTTATCCTGAGGGAGAATGG 0: 1
1: 0
2: 1
3: 23
4: 226
1093176202_1093176208 22 Left 1093176202 12:15916090-15916112 CCATAACCCACATCTTAACCATT 0: 1
1: 1
2: 1
3: 24
4: 255
Right 1093176208 12:15916135-15916157 CAATTTATCCTGAGGGAGAATGG 0: 1
1: 0
2: 1
3: 23
4: 226
1093176203_1093176208 16 Left 1093176203 12:15916096-15916118 CCCACATCTTAACCATTGCAGTT 0: 1
1: 0
2: 2
3: 17
4: 170
Right 1093176208 12:15916135-15916157 CAATTTATCCTGAGGGAGAATGG 0: 1
1: 0
2: 1
3: 23
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093176208 Original CRISPR CAATTTATCCTGAGGGAGAA TGG Intronic
901144075 1:7053535-7053557 GCATCTATCCTGAGTGAGAAGGG - Intronic
902188790 1:14745791-14745813 ATATTTATCCTGAGGGTTAAAGG - Intronic
903839784 1:26230362-26230384 AAATATATCCTGAGGGAAGAAGG + Intergenic
904909743 1:33925724-33925746 CACTTTATCCTGAGTGACAATGG - Intronic
906580168 1:46929634-46929656 CAATTGATCCTGGGAGAGCAAGG + Exonic
906603556 1:47149256-47149278 CAATTGATCCTGGGAGAGCAAGG - Exonic
907720542 1:56968004-56968026 CAATTCATCCTTTGGGACAACGG - Intergenic
908451643 1:64261926-64261948 AATTTTATCCTGAAGGAAAATGG - Intronic
908697412 1:66858909-66858931 CATTTTCTCCTGTGTGAGAAGGG - Intronic
909602583 1:77476363-77476385 CATTTTATCACCAGGGAGAAGGG - Intronic
910144275 1:84060759-84060781 TATTTTATCCTGACGGTGAAAGG - Intergenic
910205517 1:84745304-84745326 CAATTTATCATGTAGGTGAACGG - Intergenic
912757367 1:112335532-112335554 TACTTAATCCTGAGGGAGACTGG + Intergenic
915294151 1:154908351-154908373 CAATTGATCCTGGGAGAGCAAGG - Intergenic
917256257 1:173119825-173119847 ATAATTATCCTGAGGGAAAAAGG - Intergenic
917731473 1:177879277-177879299 CAATTTGTTTTGAGGAAGAATGG + Intergenic
918335109 1:183502264-183502286 CAATTTCTCATAAGGTAGAATGG - Intronic
918496206 1:185140214-185140236 CCATTTTTCCTAAGGGATAATGG - Exonic
921286078 1:213610584-213610606 TATATTTTCCTGAGGGAGAAAGG - Intergenic
921678928 1:218008595-218008617 CAATGGATCCTGAGAGAGCAAGG + Intergenic
924297598 1:242604143-242604165 CTATTTACCCAAAGGGAGAAAGG - Intergenic
1063479937 10:6366590-6366612 CACCTTATGCAGAGGGAGAAGGG - Intergenic
1064639286 10:17398955-17398977 GTAGTTTTCCTGAGGGAGAAAGG + Intronic
1064773021 10:18744098-18744120 CAATTTATCCTGTGCAACAATGG - Intergenic
1065662849 10:28023842-28023864 CAAATGATCTTGCGGGAGAATGG - Intergenic
1069279397 10:66635936-66635958 CAATTTATACTCAGAGACAAGGG - Intronic
1070581416 10:77723160-77723182 CAATCGATCCTGAGAGAGCAAGG + Intergenic
1070885222 10:79889407-79889429 CAGTTTAACCTCAGGGAAAACGG - Intergenic
1075010839 10:118868958-118868980 TAATTTATCCTGAAGGAGCTGGG + Intergenic
1077209696 11:1363603-1363625 CAATGCATCCTGGGAGAGAAAGG - Intergenic
1078299641 11:10114902-10114924 CAGTTTATCCTGTGGGAGCCTGG + Intronic
1079212870 11:18478745-18478767 CCATGTATCCTGGGAGAGAATGG + Exonic
1081214579 11:40380170-40380192 CAATTAAACCTGAGGGAGTAGGG + Intronic
1082072591 11:47950994-47951016 CAAATAATCCTGAGGGAAAAAGG - Intergenic
1084855918 11:71986143-71986165 AATTTTCTTCTGAGGGAGAAGGG - Intronic
1085673192 11:78488888-78488910 GAAGTTATCCAGAGGTAGAAAGG + Intronic
1086439105 11:86810523-86810545 GAATCTAGCCTGAGGAAGAAGGG + Exonic
1086899006 11:92345222-92345244 CAATTTTTGGTGAGGGAGACTGG - Intergenic
1088407675 11:109499096-109499118 AAATTTTTACTGAGGTAGAAGGG + Intergenic
1088793209 11:113244949-113244971 CAATTGAGGCTGAGGGAGAAGGG - Intronic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1089961894 11:122623922-122623944 GAACTTCTCCTGAGGGAGCAGGG - Intergenic
1090535277 11:127634414-127634436 GACTTTCTCCTGAAGGAGAATGG - Intergenic
1090940468 11:131383693-131383715 GATTTTATACTGAGGGAAAAGGG + Intronic
1091135896 11:133189062-133189084 CCATTTAACCAGAGAGAGAATGG - Intronic
1092920132 12:13223698-13223720 CCATTGATGCTGAGAGAGAAGGG + Intergenic
1093176208 12:15916135-15916157 CAATTTATCCTGAGGGAGAATGG + Intronic
1094269185 12:28592174-28592196 AAATTTATCCTCAGGGAGGGAGG + Intergenic
1094865774 12:34528628-34528650 CAATTTCTCCTCTGGCAGAAGGG + Intergenic
1095115172 12:38344210-38344232 CAATTGATCCTGGGAGAGCAAGG - Intergenic
1099794074 12:87374752-87374774 CAAATTATAATGAGGGTGAAGGG - Intergenic
1102809562 12:115812656-115812678 GACTTTATCCTGAGTGTGAAGGG - Intergenic
1103108993 12:118258213-118258235 GACTTTATCCTGAGGGAAAGGGG + Intronic
1103290718 12:119843946-119843968 CCATTTATCTTGAAGCAGAATGG + Intronic
1103547119 12:121710290-121710312 CAATTGATCCTGGGTGAGCAAGG + Intergenic
1105480313 13:20769389-20769411 CACTTTAGCCAGAGGGAGAGGGG - Intronic
1108495925 13:51025391-51025413 CAATTTATCCTGAGAGACTCTGG - Intergenic
1110896404 13:80758055-80758077 CATTTTATCCACAGAGAGAATGG + Intergenic
1111152562 13:84275416-84275438 AAATATTTCTTGAGGGAGAAGGG - Intergenic
1111850594 13:93568468-93568490 CAATAGATGCTGAGGTAGAAGGG + Intronic
1112185520 13:97124577-97124599 CTATTAATCATGAGGGAGATTGG + Intergenic
1113290833 13:108904291-108904313 CACTCAATCCTGAGGGAGAGTGG - Intronic
1113466410 13:110516587-110516609 CAGTTTATCCTTAGAGAGGAAGG - Intergenic
1114825067 14:26067314-26067336 CAATTTAACATGAGGGAGTGTGG - Intergenic
1114895742 14:26988924-26988946 CTAATCATCTTGAGGGAGAAGGG - Intergenic
1115469357 14:33752723-33752745 CAATTTTCCTTGACGGAGAAGGG - Intronic
1115520052 14:34224512-34224534 CAATTTATCCTTAGGGAAATAGG + Intronic
1116009469 14:39334024-39334046 AAATTTATGATGAGTGAGAAGGG + Intronic
1118196256 14:63629486-63629508 AAACTGTTCCTGAGGGAGAAAGG - Intronic
1118663287 14:68038440-68038462 CACTGCATCTTGAGGGAGAAAGG - Intronic
1120226850 14:81800428-81800450 CTATCTATCTGGAGGGAGAAAGG + Intergenic
1120314923 14:82879453-82879475 CAATTACTAGTGAGGGAGAAAGG + Intergenic
1123974803 15:25543168-25543190 GAATTTATCCTCAGGGGGCAGGG + Intergenic
1124210016 15:27755166-27755188 CATTTTGTCCTTGGGGAGAAAGG + Exonic
1125998663 15:44188693-44188715 CAATTTCTACTGAAGGAAAAGGG + Intronic
1126765828 15:52010198-52010220 CAACTTATCCTTCAGGAGAATGG - Intronic
1126829600 15:52587533-52587555 CCATGTATCTTGAGGGAGAGGGG + Intronic
1127972169 15:63970187-63970209 CACTTTACCCTGAGAGATAAGGG - Intronic
1133550868 16:6853452-6853474 CAAATCATCCTGATGGAGGATGG + Intronic
1134326096 16:13209282-13209304 CATTTCATTTTGAGGGAGAAAGG + Intronic
1135546614 16:23371246-23371268 AACTTTCTCCTGAGGCAGAAAGG - Intronic
1139538072 16:67591687-67591709 CAGTTTTTCCTGAGGATGAAAGG - Intronic
1140770403 16:78198477-78198499 CAATAAATACTGATGGAGAATGG + Intronic
1140895545 16:79321410-79321432 CATTTTATCCAGAGGAAGAGAGG + Intergenic
1141255905 16:82402098-82402120 CATTTTGCCCTGAGGGAGATGGG + Intergenic
1143523952 17:7461985-7462007 CAATTCCCCCTAAGGGAGAAGGG - Exonic
1148751477 17:49947964-49947986 CTTGTTATCCTGAGAGAGAAAGG - Intergenic
1150996456 17:70323302-70323324 CATTTCAACCTGAGGGTGAAAGG + Intergenic
1151664428 17:75537383-75537405 CATTTTATCCTAAGGGGTAAAGG - Intronic
1152136176 17:78505063-78505085 CAGTGTATCCTTAGGGAGAAAGG - Intronic
1153162531 18:2224023-2224045 TAAATTATTCTAAGGGAGAAAGG - Intergenic
1153608719 18:6860254-6860276 GAATTTATCCTGTGGGTAAAAGG - Intronic
1153741641 18:8135993-8136015 CATTTTTTCCTGTGGGAGAAAGG - Intronic
1157914989 18:51655706-51655728 CCATTTAGCCAGAGAGAGAAAGG - Intergenic
1157939926 18:51917448-51917470 GAATTTATTCTGAGGGAAACTGG + Intergenic
1160077515 18:75692466-75692488 CACTTTATCTTAAGGGACAATGG - Intergenic
1160197930 18:76772305-76772327 CAGCTTCTCCTGAGGGAAAAGGG - Intergenic
1161422178 19:4182097-4182119 CACTTTATCCTGAGGGTGATGGG - Intronic
1163059964 19:14753440-14753462 CATCATATCCTGCGGGAGAAAGG - Intronic
1163365172 19:16871949-16871971 CCACTTATCCTGAGGGAGGGTGG + Intronic
1164472801 19:28550205-28550227 CAGTCTAACCTGAGGGGGAAAGG + Intergenic
1166268046 19:41696978-41697000 CAAGGAATCCTGAGGGACAAAGG - Intronic
925162301 2:1694477-1694499 CAAGTTCTCCTGGAGGAGAAGGG + Intronic
925591405 2:5513411-5513433 CAGCTTTTCCTGAGGAAGAAGGG + Intergenic
926106367 2:10154571-10154593 CAAGTGATCTTGAGGGGGAAAGG + Intronic
927179554 2:20434986-20435008 CAATTTAAATTGAGGGAAAAGGG - Intergenic
927388599 2:22565840-22565862 AAATTTATTCTGAGCAAGAAAGG + Intergenic
928211823 2:29329165-29329187 AATTTTATCCAGAGGGGGAAGGG + Intronic
928438004 2:31268419-31268441 CAATGGAGGCTGAGGGAGAAGGG + Exonic
931943874 2:67283667-67283689 CAATTTATCCTGCTGAAAAAGGG + Intergenic
932373993 2:71218554-71218576 CAAATTATCCTGCAGGAAAATGG - Intronic
936692449 2:114906684-114906706 GAATTTATCCTGAGGATGCAAGG - Intronic
936891248 2:117372678-117372700 CAAGTTTTCTTCAGGGAGAAGGG - Intergenic
937659586 2:124415175-124415197 CTCTTTATCCAGATGGAGAATGG - Intronic
938172240 2:129089483-129089505 CACTTTGCCCTGAAGGAGAAAGG - Intergenic
939484639 2:142795651-142795673 CGATTTCTCCTGTTGGAGAATGG + Intergenic
939492527 2:142893813-142893835 CAATATATCCTTAGAGAGTAGGG - Intronic
940569960 2:155418306-155418328 CTATTTTTACTGAGGGAGGAGGG - Intergenic
940692744 2:156939793-156939815 GAATTTAAACTGAGGGAGCATGG - Intergenic
942729652 2:179050112-179050134 GAGTTTATCGTGAGAGAGAAAGG + Intergenic
944187256 2:196962603-196962625 AAATTTATCCTGAGTCAGAGCGG + Intergenic
945068484 2:205967457-205967479 CAATGGATCCTGAAGGAAAAAGG + Intergenic
945670064 2:212791875-212791897 CCATTTATGCTGCTGGAGAAGGG + Intergenic
946391543 2:219419408-219419430 CAGTGTAGCCAGAGGGAGAAGGG + Intronic
947005099 2:225502346-225502368 CAATTTATGATGAAGGAGAAAGG - Intronic
947560002 2:231140842-231140864 CACTTTAGCCTGGGGGACAAGGG + Intronic
948088992 2:235275637-235275659 AAATTTATCCTGATGGAAAAGGG + Intergenic
1169737111 20:8849024-8849046 CAGTTTGTCCTGGGAGAGAATGG + Intronic
1171057563 20:21922186-21922208 AAGTTTATCATGAGGGAGACAGG + Intergenic
1173088770 20:39950513-39950535 GAATTTTGTCTGAGGGAGAAAGG + Intergenic
1173622591 20:44448182-44448204 AACTTTATCCTGAGGGCAAAGGG + Intergenic
1177021451 21:15864001-15864023 CAATCCATCCTGGGGGAGAGTGG + Intronic
1177322843 21:19544683-19544705 CAATTGATCCTGGGAGAGCAAGG - Intergenic
1177657141 21:24032670-24032692 CAATTTATCCTTGGGGATATAGG + Intergenic
1180175998 21:46089873-46089895 CAAACTCTCTTGAGGGAGAAAGG - Intergenic
1181498922 22:23304735-23304757 TAGTGTATCCTAAGGGAGAAGGG + Intronic
1183732737 22:39627812-39627834 CACTTCATCCTGAGGGAGAAAGG + Intronic
949268587 3:2188437-2188459 CAAGTTCTCCTGAGGAAGATTGG + Intronic
949345611 3:3073577-3073599 AAATTTATCCTTAAGGTGAACGG - Intronic
949723995 3:7023013-7023035 CAGTAAATCATGAGGGAGAATGG + Intronic
951118578 3:18895475-18895497 AAATTTATTATTAGGGAGAAAGG - Intergenic
951245311 3:20334582-20334604 CAACTGATCCTGAGGGAGCTAGG - Intergenic
953452871 3:43018714-43018736 CAATTTGTCCTGATAGAAAAAGG + Intronic
956456600 3:69427194-69427216 CAATATTTTCTGTGGGAGAAGGG + Intronic
960382044 3:116974873-116974895 CAATTTATGCTGAATCAGAAGGG - Intronic
960677134 3:120206174-120206196 AAATTTATAGTGATGGAGAATGG - Intronic
960713551 3:120554960-120554982 CAATTTAACCAGATGCAGAATGG + Intergenic
961026105 3:123559332-123559354 AAATTTATCTAGAGGGAAAAAGG + Intronic
963114361 3:141713737-141713759 CAATGTGACCTGAGGAAGAAGGG + Intergenic
966746189 3:183279666-183279688 CATTTTATCCTGAAGAAAAAGGG + Intronic
967041701 3:185699301-185699323 CAATATATTTTGAGGAAGAAGGG - Intronic
967660824 3:192107556-192107578 CAATTTATGGTGAGAAAGAATGG + Intergenic
968527808 4:1072985-1073007 CAATATATGCTGAGGTACAAAGG - Exonic
969652536 4:8476284-8476306 CAATGTCTCCTGGGGGAGAGCGG + Exonic
969726531 4:8921393-8921415 CCATCTATACTGAGAGAGAAGGG - Intergenic
973087056 4:46077638-46077660 CAAATTAGACTGAGAGAGAAGGG - Intronic
974068935 4:57106661-57106683 AAATTAATTCTGAGGGAGAAAGG + Intronic
975345074 4:73283977-73283999 TAATTTATCCTGAGGGATCAGGG + Intergenic
975555957 4:75664763-75664785 CACTTTAACCTGGGGGACAAAGG + Intronic
976091602 4:81463982-81464004 CAATTTCTCCAGGGGAAGAAAGG + Intronic
977728536 4:100325128-100325150 CAATTTATTATGAAAGAGAAAGG - Intergenic
978340184 4:107714268-107714290 GAATTTATGGTGAGGGAGCAGGG - Intronic
978676464 4:111325177-111325199 CACTTTATCCTGAGGGGTGAGGG + Intergenic
979613491 4:122715057-122715079 CAAATTATTCTGAGGAATAATGG + Intergenic
980073914 4:128273308-128273330 CCATTTCTCCTCAGAGAGAATGG - Intronic
982232827 4:153224317-153224339 ATATTTACCCTAAGGGAGAAGGG - Intronic
982449573 4:155536359-155536381 CAATATATACATAGGGAGAATGG + Intergenic
982639662 4:157942492-157942514 CAATTTGTCCTCAGGAGGAAAGG + Intergenic
983108355 4:163718537-163718559 CAATCTATTCTGATGTAGAAAGG + Intronic
984666880 4:182438485-182438507 CAATTTATGATTAGTGAGAAAGG - Intronic
985063672 4:186102066-186102088 CAGTTGCTCCTGAAGGAGAAGGG + Intergenic
987684761 5:21182814-21182836 CAATTGATCCTGGGAGAGCAAGG + Intergenic
987876441 5:23687253-23687275 CAATTGATCCTGGGAGAGCAAGG - Intergenic
988342843 5:29997299-29997321 TAATTTATTCTGAGGGAAAATGG - Intergenic
989096930 5:37790486-37790508 TAATTTATCCAGAGTGAGACAGG + Intergenic
991706078 5:69360112-69360134 CTATATTTCCTGAAGGAGAATGG + Intronic
991908650 5:71538144-71538166 GAATTTATCCTGGGGAAGCAAGG - Intronic
993013625 5:82511194-82511216 CATTTTGCCCTGAGGGAGACTGG + Intergenic
993733860 5:91452461-91452483 CATATGAGCCTGAGGGAGAAAGG - Intergenic
994951242 5:106466004-106466026 CATTTTATTCTGAGAGGGAAGGG + Intergenic
994966003 5:106671767-106671789 CAATTTGTTCTGAGAGTGAAAGG + Intergenic
995576959 5:113547081-113547103 CAGTTTATATTCAGGGAGAAGGG + Intronic
995815120 5:116158508-116158530 CACTTCAGCCTGAGGGAGAAAGG - Intronic
995889824 5:116938526-116938548 CAATTTAGCCTGAGAGAAAGTGG + Intergenic
996289608 5:121836271-121836293 CACTTTATACAGAGGGAAAAAGG + Intergenic
996466271 5:123806224-123806246 AAATTCATCCTCAGGGAGGAAGG + Intergenic
998949893 5:147382853-147382875 CACTTCAGCCTGAGGGAGAGTGG + Intronic
1000102774 5:158032691-158032713 CCATATATCCTGAAGTAGAAGGG - Intergenic
1000512582 5:162202055-162202077 CATTTTTTCTTGATGGAGAATGG + Intergenic
1001314534 5:170632991-170633013 CAATTATTCCTCGGGGAGAAGGG - Intronic
1002556973 5:180049827-180049849 CAATATATTCAGAGGCAGAAAGG - Intronic
1004025419 6:11813589-11813611 CAATATTTCCTGAGGGGGAACGG - Intergenic
1004500565 6:16206283-16206305 CAAATTCTACTGAGGAAGAAAGG - Intergenic
1007478342 6:42133999-42134021 CAGGTTCTCCTGAGGGAGAAGGG - Intronic
1007865800 6:44968872-44968894 CAATGTGTGCTGAGGTAGAATGG - Intronic
1008520318 6:52356791-52356813 CATTTTATCCTGGGGGAGAGAGG - Intergenic
1009496378 6:64353579-64353601 TAATTTATCCTTATGGATAAAGG + Intronic
1011014489 6:82740013-82740035 CAATTAATCTTTAGGGTGAAAGG + Intergenic
1012614935 6:101265532-101265554 CAATTTATTTTGAGGGAGTTTGG + Intergenic
1012841883 6:104339303-104339325 CACTTAACCCTGAGGGTGAATGG + Intergenic
1014477787 6:121895946-121895968 CAATGGATCCTGGGGGAGCAAGG + Intergenic
1014886229 6:126784791-126784813 CATTTTATCCAGTGGGAAAAAGG + Intergenic
1017456478 6:154605788-154605810 AAATTTGTCCTGAAGGAGAGGGG - Intergenic
1018668352 6:166160229-166160251 CAAGTTATGCAGAGGGAAAAAGG - Intronic
1021021375 7:15602277-15602299 CAAATTATACTGAGAAAGAATGG - Intergenic
1026241431 7:68578897-68578919 CAAGTTCTCCAGAGGGACAATGG + Intergenic
1026370396 7:69692602-69692624 CAACTTTTCCTGAGGGGAAATGG + Intronic
1027446840 7:78283638-78283660 CAATTTTTCATGGGAGAGAATGG + Intronic
1027912442 7:84268542-84268564 CAATTTATCCTAAAGAAAAAGGG - Intronic
1027991744 7:85371575-85371597 CAAATTTTCCTGAAGTAGAATGG - Intergenic
1028118398 7:87028232-87028254 CAATTTTGACTGAGGGAGAGAGG - Intronic
1028698855 7:93752172-93752194 CAATCTATCCATAGGAAGAAGGG - Intronic
1031503929 7:122557517-122557539 GGATTTATCCTGAGGCAGAATGG + Intronic
1031550334 7:123103662-123103684 CAAGTCATCCTGAAAGAGAATGG - Intergenic
1032897246 7:136264704-136264726 CAATTGATCCTGGGAGAGCAAGG + Intergenic
1033298216 7:140160648-140160670 CAAGTGATCCTGAGGGAGAGTGG + Intronic
1033602521 7:142898522-142898544 CAATTGAGCCTGAGGGGGTAGGG - Intergenic
1035604730 8:922278-922300 CACTTTATTCTGAGAGAGAGAGG + Intergenic
1037739829 8:21599601-21599623 GAACTTATCCTGAGAGAGATGGG + Intergenic
1039005035 8:33026772-33026794 CACCTCACCCTGAGGGAGAAGGG - Intergenic
1039334174 8:36571892-36571914 CAATTCAGCCTCTGGGAGAAGGG - Intergenic
1042670670 8:71259484-71259506 CAATTCAGCCTGCTGGAGAAAGG + Intronic
1042841306 8:73126624-73126646 CAGTTTCTCCTGAGAAAGAAAGG + Intergenic
1046104720 8:109651740-109651762 CATTTGATCCTGAGGGACAGAGG - Intronic
1048373349 8:133799863-133799885 CAGTGTATCATAAGGGAGAAAGG + Intergenic
1048837747 8:138537424-138537446 CAGATCAGCCTGAGGGAGAATGG - Intergenic
1049808914 8:144554438-144554460 CCCTTGATCCTGGGGGAGAATGG + Intronic
1050976556 9:11945969-11945991 AAATTTGTCCTGAGGTAGCAAGG + Intergenic
1055115720 9:72603119-72603141 CAATTTCTCCTGAGTCAGGATGG - Intronic
1055424787 9:76183041-76183063 AAATTTGACTTGAGGGAGAAAGG + Intronic
1055839409 9:80484179-80484201 CAATTTATCATAAGGGAAGAAGG - Intergenic
1056775951 9:89512678-89512700 CCATGTGTCCTGCGGGAGAAGGG - Intergenic
1057864575 9:98668851-98668873 TAATTTATCCTGAAAGAGGAAGG - Intronic
1058498788 9:105589985-105590007 CCTTTTATCCTGAGTGAGACTGG + Intronic
1058852439 9:109025916-109025938 CAATCTTTCCTTAGGGAGAATGG + Intronic
1059329398 9:113525371-113525393 CAATTTAGACTGCAGGAGAAGGG - Intronic
1059773441 9:117449919-117449941 CAATTTCACCTGAGGGATAAAGG + Intergenic
1062082019 9:134629331-134629353 GAATTTCTGGTGAGGGAGAATGG - Intergenic
1186443921 X:9609598-9609620 CAATTTATCCTAAAGGAAAATGG - Intronic
1187229658 X:17408619-17408641 GAGCTTATCCTAAGGGAGAAGGG - Intronic
1187571876 X:20512444-20512466 CAATTTTTCATGAGAGAGATAGG + Intergenic
1189544719 X:42029586-42029608 ACATTTATCATGAGGGAGAGGGG - Intergenic
1191611660 X:63121877-63121899 AAATTTATCCTTAGGGTGATTGG - Intergenic
1193085580 X:77446166-77446188 CAGTTTCTCCTGAGGGAGCCTGG + Intergenic
1194195816 X:90890961-90890983 CAATTTATCCTGTGGAAGTTGGG - Intergenic
1194444384 X:93969632-93969654 CAATGTTTCCTGGGGAAGAAAGG + Intergenic
1194893068 X:99404664-99404686 GAATTTACCCTGTGGTAGAAGGG - Intergenic
1196989842 X:121316162-121316184 CAATTTATACTGACAGAGTAAGG - Intergenic
1200085201 X:153600753-153600775 CATTTTCTCCTGAAGGTGAAGGG - Intergenic
1200541670 Y:4465155-4465177 CAATTTATCCTGTGGAAGTTGGG - Intergenic
1201340456 Y:12927303-12927325 CAATTTAACCTCAGGAAGAAAGG - Intergenic