ID: 1093180335

View in Genome Browser
Species Human (GRCh38)
Location 12:15960345-15960367
Sequence AATGATATGCGGGCTGGGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 330}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093180335 Original CRISPR AATGATATGCGGGCTGGGGA CGG Intronic
900181394 1:1312574-1312596 CAGGGTATGCGGGCTGGGCAGGG - Exonic
900213747 1:1470010-1470032 AATGTTTTGCGGGCAGGGGATGG - Exonic
900275922 1:1828028-1828050 AATGATGTTCCGGCTGGGGGCGG + Intronic
901271230 1:7953576-7953598 AATAAGATGCTGGCTGGGGGCGG + Intergenic
901585549 1:10288098-10288120 AATCATATGCAGGGTGGGGCTGG + Intronic
901691309 1:10974979-10975001 GATGAAATGAGGGCTGGGCATGG + Intronic
901801361 1:11709894-11709916 AAAGATATGTGGGCTGGGCGCGG + Intronic
902048754 1:13545223-13545245 AATGATAGGTGGGGTGGGGTGGG + Intergenic
903144968 1:21365719-21365741 AAATAAATGCTGGCTGGGGATGG + Intergenic
903793500 1:25910702-25910724 AATGTTTTGGGGGCAGGGGATGG + Intergenic
905727288 1:40264039-40264061 AATGAGAAGTGGGCTGGGTACGG + Intronic
906267299 1:44442431-44442453 GATAATATGCAGGCTGGGCACGG - Intronic
906285937 1:44587949-44587971 AGTTATGTGTGGGCTGGGGATGG + Intronic
906930626 1:50166339-50166361 AATGGTATTTGGGTTGGGGATGG - Intronic
907607058 1:55828653-55828675 AAAGATCTGGGGGCTGGGCATGG + Intergenic
908102189 1:60802838-60802860 AATGATGTGTGGGTTGGTGAGGG - Intergenic
909558019 1:76976742-76976764 AATGATATGGGGGCTCAGGGGGG - Intronic
910042770 1:82873543-82873565 AATGAAATGCGAGCTGGAGAAGG + Intergenic
911935548 1:103965740-103965762 AATGTTTTGTGGGCAGGGGATGG + Intergenic
913511845 1:119569302-119569324 AATGATATGAGAGCGGGGAAGGG - Intergenic
916490109 1:165294671-165294693 AATTACATGCGGGCTGGGCACGG + Intronic
916757243 1:167784365-167784387 AATGAAATGGAGGGTGGGGAGGG + Intronic
917721633 1:177791614-177791636 AAAGATTTGGGGGCTGGGCACGG - Intergenic
917749367 1:178040482-178040504 AATGTTTTGCGGGCAGGGGGTGG - Intergenic
919548245 1:198950142-198950164 AATGATATGGGGACATGGGAGGG + Intergenic
919681376 1:200438594-200438616 AAAGAAATCCGGGCTGGGCACGG + Intergenic
919716566 1:200783776-200783798 AATGAAACGCAGGCTGGGCATGG - Intronic
923642027 1:235773024-235773046 AAGAATATGCTGGCTGGGGGTGG + Intronic
924589661 1:245391499-245391521 AGAGATTTGTGGGCTGGGGATGG + Intronic
1063467076 10:6253749-6253771 GGTGATATGCTGGCTGGGCACGG + Intergenic
1063585155 10:7345645-7345667 AAAGATATTTGGGCTGGGCACGG - Intronic
1064338359 10:14464195-14464217 AATTATTTGTGGGCTGGGCACGG - Intergenic
1065956923 10:30702135-30702157 GAAGATATGCGTGCTGCGGAGGG - Intergenic
1066284765 10:33953935-33953957 AATGATCTGATGGCTGGGCATGG - Intergenic
1066675694 10:37884750-37884772 AATGATATGAGGGTTGGAGTTGG + Intergenic
1067460979 10:46458271-46458293 AATGATATCTAGGCTGGGCACGG + Intergenic
1067544243 10:47181443-47181465 AAGGATATGGGGGTTGGGCATGG - Intergenic
1067626214 10:47926329-47926351 AATGATATCTAGGCTGGGCACGG - Intergenic
1068512125 10:57979796-57979818 AAGGTTATGCGGACTGGGCAAGG - Intergenic
1068912613 10:62394939-62394961 AGTGAGATCCGGGCTGGGGATGG + Intronic
1070249535 10:74762005-74762027 AATGAGATTCAGGCTGGGCATGG + Intergenic
1070532650 10:77350686-77350708 GATGATATGCATGCAGGGGAAGG - Intronic
1072064728 10:91855459-91855481 AAGAATATGAGGGCTGGGCATGG - Intronic
1072738830 10:97897225-97897247 AATTATAGGCAGCCTGGGGAAGG + Intronic
1072858311 10:98973998-98974020 AATGATTTGTAGGCTGGGCATGG + Intronic
1074156659 10:110805907-110805929 AATAATATAGGGGGTGGGGAAGG + Intronic
1074779468 10:116790657-116790679 AATGAGATGGGGTCTGGGAATGG - Intergenic
1075700531 10:124466745-124466767 AATGATATGCAGGCTGGGCGCGG - Intronic
1077389725 11:2294653-2294675 AATGACAGGGTGGCTGGGGAAGG + Intergenic
1077403178 11:2369002-2369024 GATGGCATGCGGGGTGGGGATGG - Intergenic
1078504010 11:11916156-11916178 AAGGATGTGCAGGCTGGGCATGG + Intronic
1078540559 11:12209860-12209882 GTTGTTATGCGGGCTGGGAAAGG + Intronic
1079125144 11:17713794-17713816 ACTGACATGCGGGCAGGGCAGGG - Intergenic
1079955131 11:26852726-26852748 AATGATATTTGGGCTGGGCATGG - Intergenic
1081487367 11:43542022-43542044 AAAGAAATGTGGGCTGGGCATGG + Intergenic
1081927314 11:46841708-46841730 AGTGATATGCTGGCTCGGCACGG + Intronic
1083036305 11:59640734-59640756 AATGAACAGGGGGCTGGGGATGG + Intronic
1083902870 11:65652186-65652208 AAGGAGAGGCAGGCTGGGGATGG + Intergenic
1083904287 11:65660061-65660083 CAGGAAAGGCGGGCTGGGGAGGG + Intronic
1084305762 11:68282453-68282475 AAAGAGATGGGGGGTGGGGAGGG - Intergenic
1084687624 11:70706232-70706254 AGTGAAATGTGAGCTGGGGAAGG - Intronic
1085161292 11:74348704-74348726 AATGACATTTGGGTTGGGGAAGG - Intronic
1085614904 11:77989923-77989945 AATGATTTTTGGGCTGGGAATGG + Intronic
1085655317 11:78309401-78309423 AATTACATGAAGGCTGGGGAGGG - Intronic
1087078330 11:94146442-94146464 AATGATAAGTGGTCTGTGGAGGG - Intronic
1087121238 11:94576422-94576444 AATGATATAGAGGCTGGGCACGG - Intronic
1088916997 11:114235033-114235055 AAGGATTTGGGGGCTGGGGGTGG + Intronic
1089454508 11:118618204-118618226 AAGGCTATGGGGGTTGGGGAGGG - Intronic
1090081388 11:123615394-123615416 GATGCTATGCTGGCTGGGCATGG + Intronic
1090303451 11:125668845-125668867 AATAAAATGAAGGCTGGGGACGG - Intronic
1090849219 11:130556997-130557019 AGTTATATGCAGGCTGGGCATGG - Intergenic
1091743361 12:2975676-2975698 AATAATGTGCTGGCTGGGCACGG - Intronic
1092498223 12:9019597-9019619 AATGAGATCCTGGCTGGGCACGG + Intergenic
1092613629 12:10196746-10196768 AATGATAGGAGGGCCGGGCACGG - Intergenic
1093180335 12:15960345-15960367 AATGATATGCGGGCTGGGGACGG + Intronic
1094337785 12:29380593-29380615 AATGAGAAGGGGGCGGGGGAGGG - Intronic
1094606982 12:31957696-31957718 AATGTTTTGCGGGCAGGGGGTGG - Intergenic
1095491524 12:42739503-42739525 CATGGTATGGGGGTTGGGGAAGG + Intergenic
1096206656 12:49728281-49728303 AATGTTTTGAGGGCTGGGCATGG + Intronic
1097225603 12:57475461-57475483 AGTGAGGCGCGGGCTGGGGAGGG - Exonic
1098406412 12:70131393-70131415 AATGTTTTGCGGGCAGGGGGTGG + Intergenic
1101387593 12:104271528-104271550 AATGTTTTGTGGGCAGGGGATGG + Intronic
1102099903 12:110270266-110270288 AAGGATAAGCGGGCTTGAGAGGG + Intergenic
1103526223 12:121570475-121570497 AAAGATATGCAGGCTGGGTGCGG - Intronic
1103744266 12:123111475-123111497 AATGGAATGGTGGCTGGGGATGG + Intronic
1103822279 12:123708697-123708719 AAAGATATGGGGGCTGCGGGAGG + Intergenic
1104273704 12:127305483-127305505 AATGAGATGGGAGCTGTGGAGGG + Intergenic
1104315044 12:127690782-127690804 AAGGACATCCGGGCTGGGCACGG + Intergenic
1104547995 12:129729956-129729978 AATTTTTTGCGGGCAGGGGATGG - Intronic
1104879563 12:132061115-132061137 AATAACATGCAAGCTGGGGAAGG + Intronic
1105618211 13:22040786-22040808 AATGATATGGGAGGGGGGGAAGG + Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1106179331 13:27357782-27357804 AATGCAATGCAGGCTGGGCATGG + Intergenic
1106871402 13:34025875-34025897 AAGGACATGGGGGCTGGGCATGG - Intergenic
1107442868 13:40443847-40443869 AATGATGTGCTTGCAGGGGAAGG + Intergenic
1107496950 13:40935928-40935950 AATGGTATCTGGGCTGGGCACGG - Intronic
1107816664 13:44250581-44250603 AATGAGATGGTGGCTGGGAAGGG + Intergenic
1108677288 13:52748101-52748123 AAAGAAAAGCGGGCTGGGCATGG + Intergenic
1109458408 13:62624409-62624431 AATGTTTTGCGGGCAGGGGGTGG - Intergenic
1110277799 13:73659372-73659394 AATCATATGTTGGCTGGGCATGG - Intergenic
1112284945 13:98096019-98096041 AAGGAAATGCGGGCTGGAAAAGG - Intergenic
1112499270 13:99929979-99930001 AAAAAAATGCGGGCTGGGGGTGG - Intergenic
1112555658 13:100466415-100466437 AAACATATGCCGGCTTGGGAAGG - Intronic
1116636682 14:47404782-47404804 AATGATAGGTAGGCTGGGCATGG - Intronic
1117174929 14:53136135-53136157 AATGTTTTGCGGGCAGGGGGTGG - Intronic
1117927327 14:60795874-60795896 GATGATATTGGGACTGGGGATGG + Intronic
1119543725 14:75457073-75457095 CATGAGATGCGGGCTGAGGGTGG - Intronic
1119900366 14:78254388-78254410 AAAAACATGGGGGCTGGGGACGG + Intronic
1120211972 14:81642057-81642079 AATGATATGGGAGCAGGGCAGGG - Intergenic
1120660889 14:87249964-87249986 AAAGAAATGTGGGCTGGGCATGG + Intergenic
1122136418 14:99635411-99635433 AATCAGATGCGGGGTGGGGGTGG + Intergenic
1122681280 14:103465256-103465278 AATAATATGGGGGCTGGGCACGG - Intronic
1123687422 15:22808958-22808980 AATGAAATGGGGGCTGGGCCCGG - Intronic
1123891765 15:24788522-24788544 AACTATATGCAGGCTGGAGATGG - Intergenic
1125164101 15:36682481-36682503 AATGATGTTTGGGCTGGGCAAGG + Intronic
1126675281 15:51155452-51155474 AAGGGTGTGCGGACTGGGGAAGG + Intergenic
1127139156 15:55956102-55956124 AAAGAAATGTGGGCTGGGCATGG - Intronic
1127382733 15:58443839-58443861 AATGTTTTGCGGGCAGGGGGTGG + Intronic
1127566441 15:60193693-60193715 AATGAAATTCTGGCTGGGCATGG - Intergenic
1130337730 15:82971765-82971787 ACTGATATGGGGGTGGGGGAGGG + Intronic
1130514735 15:84617534-84617556 AGTGATATGAGGGGTGGGGCTGG + Intronic
1130661853 15:85837087-85837109 AATGAGATGCAGGCCGGGCACGG - Intergenic
1131563880 15:93468082-93468104 AATGTTTTGGGGGCAGGGGATGG + Intergenic
1131972138 15:97903621-97903643 AATGATGTGGGGGGCGGGGAAGG + Intergenic
1132153074 15:99475948-99475970 AATGCTATCTGGGGTGGGGAGGG - Intergenic
1132476565 16:142031-142053 AATGTTATGCAGGCCGGGCACGG - Intergenic
1132736429 16:1388280-1388302 ACTGATCTGAGGGCTGGGCACGG + Intronic
1133184293 16:4084433-4084455 AATGAAATGTTGGCTGGGCACGG + Intronic
1133770628 16:8865560-8865582 CATGGGATGCTGGCTGGGGAAGG + Intronic
1134569919 16:15282231-15282253 CAAAATATGTGGGCTGGGGAGGG + Intergenic
1134732458 16:16473821-16473843 CAAAATATGTGGGCTGGGGAGGG - Intergenic
1134759902 16:16705092-16705114 AATGAAATGCAGGCTGGGCATGG + Intergenic
1134934979 16:18238145-18238167 CAAAATATGTGGGCTGGGGAGGG + Intergenic
1134986170 16:18654113-18654135 AATGAAATGCAGGCTGGGCATGG - Intergenic
1136093001 16:27934109-27934131 AATGACCTGCGTGCTGGGGAAGG - Intronic
1140069534 16:71637161-71637183 AATGATATTCGGACTGTTGAAGG - Intronic
1140120941 16:72082479-72082501 AATGAAATGCGGGCTGGGCACGG - Intronic
1140614845 16:76649381-76649403 AATGATATGGAAGGTGGGGAAGG - Intergenic
1142973542 17:3629438-3629460 AAGGATATGCCGGCCGGGCATGG + Intronic
1143145893 17:4775150-4775172 AATGAGATGAGGTCTGAGGAGGG + Intronic
1143385091 17:6524327-6524349 AGTGGTATGTGGGGTGGGGAAGG + Intronic
1143564596 17:7714008-7714030 AATCCTATGCGGTTTGGGGATGG - Intergenic
1143769655 17:9160393-9160415 AAAGATGTCCGGGCTGGGCATGG - Intronic
1143953568 17:10652361-10652383 TTAGATATGCGGGCAGGGGAGGG - Intronic
1144579588 17:16450847-16450869 ACTGATATGCTGGATGGAGAAGG + Intronic
1145748304 17:27336839-27336861 AATGTTATGTCGGCTGGGCACGG + Intergenic
1146274946 17:31510572-31510594 GATGAGATGCTGCCTGGGGAAGG - Intronic
1146548028 17:33755939-33755961 GATGATAAGCAGGGTGGGGAAGG + Intronic
1147749232 17:42718392-42718414 AAGGAAATGGTGGCTGGGGATGG + Intronic
1148566656 17:48636897-48636919 AAGGAGATTCGGGCTGTGGAAGG - Intergenic
1148600134 17:48887989-48888011 AATGGAATGCAGGCTGGGCACGG + Intergenic
1149009558 17:51841224-51841246 AATGACATGCGGACTGAAGATGG - Intronic
1149502197 17:57162024-57162046 AATTAAATGGGGGCTGGGGGAGG - Intergenic
1149788743 17:59458908-59458930 AATGATATTTAGGCTGGGCATGG + Intergenic
1152346856 17:79757940-79757962 AATGATTTCCAGGCTGGGCAAGG + Intergenic
1152637197 17:81435030-81435052 AGAGAAATGGGGGCTGGGGACGG - Intronic
1153001589 18:460330-460352 AATGAAACTTGGGCTGGGGATGG - Intronic
1154139744 18:11812551-11812573 AATGACATTCAGGCTGGGCACGG + Intronic
1154402614 18:14056009-14056031 CATGCTAGGCGGGCTGTGGAAGG - Intergenic
1154952271 18:21221943-21221965 TATGATATGAGGGCCGGGCACGG - Intergenic
1157420394 18:47543013-47543035 AAACATATGCAAGCTGGGGAAGG + Intergenic
1157928424 18:51791660-51791682 AGTGATATGTGGACTGGGGATGG - Intergenic
1158482477 18:57834328-57834350 AAAGAGATGGGGGCTGGGCACGG + Intergenic
1159560178 18:69985122-69985144 AATGGTATGTTGGCTGGGCACGG - Intergenic
1160036585 18:75307284-75307306 AATGATTTGGTGGCTGGGCATGG + Intergenic
1162506344 19:11087868-11087890 AATAATTAGCGGGCTGGGCATGG - Intergenic
1163197158 19:15730363-15730385 AATGATATACTGGCTGGGCACGG - Intergenic
1163892783 19:20031650-20031672 AATGATATGTCGGCCGGGCACGG + Intronic
1164924442 19:32117771-32117793 AATTATATGCTGGCTGGGTATGG - Intergenic
1165645786 19:37434825-37434847 AATGTTTTGCGGGCAGGGGGTGG - Intronic
1166059071 19:40313613-40313635 AAGGAAAAGCGGGCTGGGCATGG - Intergenic
1166116682 19:40660213-40660235 AATGTTTTGCGGGCAGGGGGCGG - Intergenic
1167228156 19:48263845-48263867 AATGAAATGCAGGCTGGGCACGG + Intronic
1167918333 19:52760706-52760728 AATGTTTTGCGGGCAGGGGGTGG + Intergenic
1168143257 19:54403629-54403651 AATGTTTTGCGGGCAGGGGGTGG + Intergenic
1168185346 19:54696726-54696748 GATGATCTGAGGGGTGGGGAAGG + Intronic
1168426764 19:56245345-56245367 AATGAGATGCGTCCGGGGGAAGG + Exonic
1168599165 19:57704499-57704521 AATGAAATGCCAGCTCGGGATGG + Intronic
925474125 2:4193558-4193580 ACAGTTATGAGGGCTGGGGAGGG + Intergenic
926184679 2:10679909-10679931 AATAATATGTGGGCTGGGCGGGG - Intronic
926290456 2:11525212-11525234 AATGGCATCCGGGCTGGGCACGG + Intergenic
927886703 2:26723272-26723294 AGGGAGATGCGGGGTGGGGATGG - Intronic
928264535 2:29800560-29800582 AATGATTTTAGGGCTGGGGTTGG - Intronic
928416216 2:31094267-31094289 AATGTTTTGTGGGCAGGGGATGG - Intronic
928677982 2:33668900-33668922 AAAGAGATGAGGGCTGGGGGCGG + Intergenic
929653584 2:43706905-43706927 AATCATATGCTGGCTGGGCACGG + Intronic
930776333 2:55174901-55174923 AATGAGCTGCTGGCTGGGCAAGG - Intronic
931701393 2:64912084-64912106 AATTTTATGTGGGCTGGGCAAGG - Intergenic
932296607 2:70629116-70629138 AATGAAATGAAGGCTGGGCATGG + Intronic
933877346 2:86632435-86632457 AATTATATCAGGGCTGGGCACGG + Intronic
935540474 2:104341963-104341985 AATGGTATTCTGGCTTGGGAAGG - Intergenic
936456083 2:112675317-112675339 AAGGATATGGGGGCTGGGCGTGG + Intergenic
936524417 2:113233088-113233110 AATGGGATGCGGGGTAGGGAGGG - Intronic
936805063 2:116321393-116321415 AATGATATGAAGGCTGGGAAAGG + Intergenic
937231115 2:120398764-120398786 TCTGATCTGAGGGCTGGGGATGG - Intergenic
937525251 2:122760601-122760623 GATGAAATGGAGGCTGGGGAGGG - Intergenic
939778393 2:146413513-146413535 ATTGATATGGGAGCGGGGGAAGG - Intergenic
939973184 2:148685468-148685490 AAAGTTATGCTGGCTGGGCACGG + Intronic
940622397 2:156128390-156128412 AAAAATATGGGGGCTGGAGAGGG - Intergenic
942295717 2:174515252-174515274 AATGATATGGTGGCCGGGCATGG + Intergenic
943063271 2:183060865-183060887 AATTATTTGCGGGCGGGGGATGG - Intergenic
943625281 2:190191433-190191455 AATTGTATGCTGGCTGGGGACGG - Intronic
943672170 2:190674758-190674780 AAAGAAATGTGGGCTGGGTATGG + Intronic
945853983 2:215045322-215045344 ACTGATATGCAGGCTTGGAAAGG + Intronic
945975729 2:216269124-216269146 ATTGATATGGGGTCAGGGGAAGG - Intronic
946054264 2:216887276-216887298 AGTGATCTGCGTGCTGGGAAAGG + Intergenic
947617510 2:231568030-231568052 AATGAGATCCAGGCTGGGCACGG - Intergenic
948510260 2:238459152-238459174 AATGATCTGCAGGCTGGAGGAGG + Intergenic
948788431 2:240365079-240365101 AATGTAGTGAGGGCTGGGGAGGG - Intergenic
1168780826 20:488293-488315 ACTGATGTGCAGGCTGGGCACGG - Intronic
1170792846 20:19521853-19521875 GAGGAGATGGGGGCTGGGGAAGG - Intronic
1170936383 20:20813596-20813618 AATTATATGCTGGCTGGGCGTGG - Intergenic
1171795054 20:29560134-29560156 AATGATAAGAGGGCAGGGGGTGG - Intergenic
1172222747 20:33284938-33284960 AATACTAAGGGGGCTGGGGAGGG - Intronic
1172991019 20:39036961-39036983 AATGATCTGTGGGCTGTGGAAGG - Intronic
1174645718 20:52083927-52083949 AATGGGGCGCGGGCTGGGGATGG + Intronic
1175016418 20:55796071-55796093 AATGTTTTGCGGGCAGGGGGTGG + Intergenic
1175272757 20:57746453-57746475 AAGGAGATGCGGGCAGGGGGAGG + Intergenic
1178864051 21:36313052-36313074 AATGAGATATGGGCTGGGCAAGG - Intergenic
1178897467 21:36571128-36571150 AAGGAGATGCAGGCTGGGCACGG - Intronic
1179506771 21:41846411-41846433 AATGTTCTGCAGGCTGGGCACGG + Intronic
1180636562 22:17266780-17266802 CTTGATCTGGGGGCTGGGGAAGG + Intergenic
1181035728 22:20168940-20168962 AGTGATCTGCGGACTGGGGAGGG + Intergenic
1182122184 22:27795376-27795398 AATGGCATGGGGGCTGGGGGAGG - Intronic
1182944927 22:34312891-34312913 AATGACAAGAGGGGTGGGGATGG + Intergenic
1184007901 22:41724194-41724216 AATAATATACTGGCTGGGGGCGG + Intronic
1184482619 22:44756652-44756674 AATGATATGGGGAATAGGGAGGG - Intronic
1184913374 22:47550642-47550664 AGTGATGTGGGGGCTGGGGGGGG + Intergenic
949452726 3:4205253-4205275 AATGTTTTGCGGGCAGGGGGTGG - Intronic
949528530 3:4930318-4930340 AATATTATGCTGGCTGGGCAAGG - Intergenic
950391401 3:12699611-12699633 AATCACATGGGGGCTGGGCATGG - Intergenic
950727143 3:14923821-14923843 AAGGCTATGGGGGCTGGGGAGGG - Intronic
950852889 3:16079717-16079739 AAGGATATGTGGACTCGGGAAGG - Intergenic
953320256 3:41964825-41964847 AATGTTTTGCGGGCAGAGGATGG - Intergenic
953390752 3:42532370-42532392 GATGATTTGAGGACTGGGGATGG - Intronic
955761738 3:62292267-62292289 AATGAAATGCTGGTGGGGGAGGG - Intronic
957409801 3:79824660-79824682 AATGATGTGCTGCCTGGGGTTGG + Intergenic
958104338 3:89053431-89053453 AAAGATTTGGGGGATGGGGATGG + Intergenic
959018609 3:101164046-101164068 AATAATATTCTGGCTGGGCATGG + Intergenic
959932450 3:111999143-111999165 ATTGATAGGCGGGATAGGGAGGG + Intronic
961073745 3:123962437-123962459 AGTTATGTGAGGGCTGGGGAAGG - Intergenic
961309817 3:125989368-125989390 AGTTATGTGAGGGCTGGGGAAGG + Intergenic
961512720 3:127413014-127413036 GGTGAGATGGGGGCTGGGGAGGG - Intergenic
961661898 3:128473418-128473440 ACTGGTATGCGGGCTGGAGTTGG - Intergenic
962547411 3:136451471-136451493 AAAGGTATGCAGGCTGGGCATGG + Intronic
963413676 3:144965011-144965033 AATGAATTGTGTGCTGGGGAAGG + Intergenic
964856667 3:161153127-161153149 TATTATATGTGGGCTGGGCATGG - Intronic
965341585 3:167498128-167498150 AATGAAATGGGGGCTGGGCGCGG - Intronic
966835951 3:184049619-184049641 AATGATATCCGGGCCAGGCATGG + Intergenic
967394286 3:188989921-188989943 GAAGATATGCGGCCTGGGAATGG - Intronic
971089073 4:23318694-23318716 CATGAGATGCAGGCTAGGGATGG - Intergenic
971411243 4:26375010-26375032 ATTGATGTGAGGGCTGGGCACGG + Intronic
972104347 4:35463150-35463172 AATGATATGGGAGCGGGGCAGGG + Intergenic
973652157 4:53006988-53007010 AATGAAATATGGGCTGGGCACGG + Intronic
974967729 4:68783608-68783630 AATAATTTCCGGGTTGGGGAAGG + Intergenic
975003246 4:69253181-69253203 AATGCTGTACGGGCTAGGGAAGG - Intergenic
975330438 4:73106588-73106610 AAAAATACGCGGGCTGGGCACGG + Intronic
975889006 4:79001707-79001729 AGTCATATGGGGGCTGGGCATGG - Intergenic
976396200 4:84558357-84558379 ATTGGTATGGGGGCGGGGGAGGG - Intergenic
976554288 4:86432568-86432590 AATGAAATCCTGGCTGGGCATGG - Intronic
977029628 4:91865078-91865100 AATAATTTGTGGGCTGGGCATGG - Intergenic
977148362 4:93475990-93476012 AATGAAATGAGGGCTGGGAAAGG - Intronic
977383839 4:96312091-96312113 ATTGAAATGTGTGCTGGGGAGGG + Intergenic
978582327 4:110244544-110244566 AATGACATTTGGGCTGGGTATGG - Intergenic
980116417 4:128683785-128683807 AATTATGTGGGGGCAGGGGATGG - Intergenic
984193840 4:176634913-176634935 AATGATGTGGGGGCTGGAAAGGG + Intergenic
986298706 5:6461544-6461566 AATGATATGCCGGCGGGGGGGGG - Intronic
986828171 5:11544690-11544712 AATGCCATGAGGGCTGGGCATGG + Intronic
986867529 5:12007660-12007682 AATGAGATTTGGGGTGGGGAGGG - Intergenic
988203233 5:28097171-28097193 AATGAAATGGTGGCTGGGGATGG - Intergenic
988860123 5:35268711-35268733 AATGTTTTGCAGGCTGGGGGTGG + Intergenic
989620930 5:43383794-43383816 AGTGACATGCAGGCTGGGCACGG + Intronic
991691409 5:69228722-69228744 ATTGATAAGAGGGCTGGGCATGG + Intronic
993926234 5:93869806-93869828 AATGTTTTGCGGGCAGGGGGTGG - Intronic
994294729 5:98077372-98077394 AATGATCTGAAGGCTGGGCATGG + Intergenic
994375248 5:99010992-99011014 AATGTTTTGAGGGCAGGGGATGG + Intergenic
995168389 5:109075711-109075733 AATGCTAAGCGGGCTGGGCATGG - Intronic
997806646 5:136924520-136924542 ACTGATATGCAAGATGGGGAGGG + Intergenic
998247705 5:140523396-140523418 AGTTATATGCAGGCTGGGCATGG - Intronic
999851889 5:155549519-155549541 AATGAGATCCGGGCCGGGCACGG - Intergenic
1000963400 5:167627014-167627036 AATGACATGAGGGCTTGGAAAGG + Intronic
1001926526 5:175640902-175640924 AATGTGATGAGGGCTTGGGAGGG - Intergenic
1002101934 5:176862112-176862134 AATAACATGCGGGGTGGGCACGG - Intronic
1002428502 5:179189663-179189685 AATTTTTTGTGGGCTGGGGACGG + Intronic
1003919087 6:10815330-10815352 AAAGAGATGCGGGCTGGGTGCGG + Intronic
1004919349 6:20361537-20361559 AAAAAGATGCGGGCTGGGCATGG + Intergenic
1006546008 6:34782039-34782061 AATGAAGTGCAGGCTGGGCACGG - Intergenic
1007090597 6:39182205-39182227 AATGATTTGCAGGCTGGGAAGGG - Intergenic
1007754715 6:44091691-44091713 AATGCTGTGCAGGCTGGGCACGG - Intergenic
1008851519 6:56028052-56028074 ATTGAAATGAGGGGTGGGGATGG + Intergenic
1010585863 6:77658187-77658209 AATGTTTTGCGGGCAGGGGGTGG + Intergenic
1010587084 6:77666166-77666188 AATGTTTTGCGGGCAGGGGGTGG + Intergenic
1013515930 6:110885962-110885984 AAAGATTTGCCGGCTGGGCACGG + Intronic
1013731141 6:113168919-113168941 AAAGATCTGGGGGCTGGGGATGG + Intergenic
1014303192 6:119709435-119709457 AATTATATGGGGGCTTGGGGAGG - Intergenic
1015456072 6:133428213-133428235 AGAGATATGAGGGCTGAGGAGGG + Intronic
1015966874 6:138703069-138703091 AATGAAATGCAGACTGGGCATGG + Intergenic
1017419510 6:154259360-154259382 TATGAAATGCGCGCTGGGCATGG + Intronic
1017797939 6:157864665-157864687 ACAGAAATGCGGGCAGGGGACGG - Intronic
1017855148 6:158344157-158344179 AATGTTTTGCGGGCAGGGGGTGG - Intronic
1018195346 6:161351613-161351635 AATAATATGCTGGCTGGGTGCGG - Intronic
1019981607 7:4625566-4625588 AAAGAGATGGGGGCTGGGCATGG - Intergenic
1020703846 7:11517366-11517388 AATGATATGGGGGCCGGGCATGG - Intronic
1022006625 7:26271716-26271738 AATGTTTTGCGGGCAGGGGGTGG - Intergenic
1023396870 7:39759568-39759590 AATGATAAGGGGACTAGGGATGG - Intergenic
1026490635 7:70860322-70860344 AATGTTTTGCGGGCAGGGGATGG - Intergenic
1026528284 7:71174616-71174638 AATGTTTTGCGGGCAGGGGATGG + Intronic
1027820822 7:83042568-83042590 AATGATAAGGGGACTGGGCACGG + Intronic
1029546516 7:101213009-101213031 TCTGATATGGGGGCTGGGAAGGG + Intronic
1029680376 7:102104599-102104621 AATGATATTCTGGCTGGGTGTGG + Intronic
1030464326 7:109880815-109880837 AATAATAAGTGGGCTGGGCATGG + Intergenic
1031866963 7:127048146-127048168 AATGGTAAGCGGGAAGGGGAGGG + Intronic
1032116557 7:129122719-129122741 ACTGACATGGGGGCTGGGGCTGG + Intergenic
1033084439 7:138329496-138329518 AATGTTTTGCAGGCAGGGGATGG - Intergenic
1034529776 7:151688462-151688484 GATGAGATGCGGTGTGGGGAGGG + Intronic
1035181305 7:157091418-157091440 AAAGATATGCAGGCTGGGTGCGG + Intergenic
1035675677 8:1454123-1454145 AATGTTTTCTGGGCTGGGGATGG + Intergenic
1035678890 8:1473219-1473241 AATCATTTGTGGGCTGGGCACGG - Intergenic
1035915093 8:3610247-3610269 ATCGATATGTGGGCTGGGCACGG + Intronic
1037314573 8:17589085-17589107 AAAGCTATGAGGGCTGGGCATGG + Intronic
1037594731 8:20345527-20345549 AATGAACTGGGGGCTGGGCACGG + Intergenic
1039499364 8:38004518-38004540 AATGTTTTGCGGGCAGGGGATGG - Intergenic
1041039013 8:53827089-53827111 AATAAAATGCAGGCTGGGCATGG + Intronic
1041236664 8:55809723-55809745 AAAGAAATGCTGGCTGGGCACGG - Intronic
1041256528 8:55983739-55983761 AATGAGAAGCTGGCTGGTGAGGG - Intronic
1041456974 8:58071611-58071633 AAGGAAATGTGGGGTGGGGAGGG - Intronic
1043393177 8:79810731-79810753 AATGATAGGCTGGCTGGGTGTGG - Intergenic
1044513200 8:93108043-93108065 AAACATATGCAGGCTGGGGACGG - Intergenic
1045652809 8:104357217-104357239 AGTGATATGGGGGCTGGGCATGG - Intronic
1045930835 8:107624605-107624627 AATGATAACGGGGCTGGGCATGG - Intergenic
1046246687 8:111572781-111572803 AAGTATATGCAGGCTGGGCATGG - Intergenic
1046932926 8:119858914-119858936 ATTTATATGTGGGCTGGGCACGG - Intergenic
1046943388 8:119952846-119952868 TCTGATATGCAGGCTGGTGAAGG + Intronic
1047154597 8:122302696-122302718 AATGATATGGTGGGTGGGGGAGG + Intergenic
1047983982 8:130213840-130213862 CATGGTATGAGGGCTGGGGAGGG + Intronic
1048818982 8:138362264-138362286 AAAGATATGGGGGTGGGGGATGG - Intronic
1050815480 9:9806532-9806554 AATTTTTTGCGGGCAGGGGATGG - Intronic
1051076964 9:13250836-13250858 AATGAACTGTGGGCTGGGCATGG + Intronic
1053485118 9:38447149-38447171 GATGATATTTGGGCTGGGCAAGG - Intergenic
1054877758 9:70114246-70114268 AATGACATGTGGGCTGGGTGAGG + Intronic
1055482534 9:76724083-76724105 AATGATATGCTGGCCGGGTGCGG - Intronic
1056717992 9:89048969-89048991 AATGATATGCCGGCCGGGCACGG + Intronic
1057323223 9:94033149-94033171 AAGGACGTGCAGGCTGGGGACGG - Intronic
1058728298 9:107824666-107824688 AATGATATGTGGGTTGAGAAGGG + Intergenic
1058810430 9:108633771-108633793 AATCCTATGTGGGCTGGGTATGG - Intergenic
1060499698 9:124143823-124143845 AATGTTTTGCGGGCAGGGGTTGG - Intergenic
1060689836 9:125647915-125647937 AAAGATATTGGGACTGGGGAAGG - Intronic
1060946550 9:127572752-127572774 AATGATATTCAGGCTGAGCACGG + Intronic
1061032940 9:128097858-128097880 AATGCAATGTGGGCTGTGGAGGG + Intronic
1061186546 9:129058104-129058126 AGTTATATGTGGGCTGGGCACGG + Intronic
1061234992 9:129337054-129337076 AATTGTTTGCGGGCTGGGGGTGG + Intergenic
1061501149 9:131003069-131003091 AAAAATATGTGGGCTGGGCATGG + Intergenic
1061532287 9:131224022-131224044 AGTGATTTGGGGGCTGGGCATGG - Intronic
1062087706 9:134657336-134657358 GATAATATGGGGGCTGGGGTAGG + Intronic
1062632632 9:137472294-137472316 AATGAGATGGAGGCTGGGTACGG + Intronic
1203361724 Un_KI270442v1:222317-222339 AATGATAAGATGGCGGGGGAAGG + Intergenic
1185817994 X:3174078-3174100 AATAATATTTGGGCTGGGCACGG + Intergenic
1188406010 X:29810476-29810498 AAGGAAATGTGGGCTGGGTACGG - Intronic
1188618920 X:32195212-32195234 AAATAGATGAGGGCTGGGGAAGG + Intronic
1189004698 X:36983587-36983609 TATGACTTGCGGGGTGGGGATGG + Intergenic
1190401829 X:50044627-50044649 AATTTTTTGCGGGCAGGGGATGG + Intronic
1195822894 X:108966453-108966475 AATGATGGTCAGGCTGGGGATGG - Intergenic
1198246035 X:134832691-134832713 AATGAGATCCAGGCTGGGCACGG - Intronic
1198252698 X:134896263-134896285 AAGGAAATGAGGGCTGGAGAGGG + Intronic
1198966509 X:142232868-142232890 AATGTTTTGCGGGCAGGGGGTGG - Intergenic
1199614444 X:149645766-149645788 AATGATAGTTGGGCTGGGCACGG - Intergenic
1201267616 Y:12223434-12223456 AATAATATGGTGGCTGGGCACGG + Intergenic
1201941230 Y:19462587-19462609 AATAATATTCGGGCTGGGTATGG + Intergenic