ID: 1093181921

View in Genome Browser
Species Human (GRCh38)
Location 12:15976451-15976473
Sequence CTGGGGCCTAGAGAAATTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 200}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093181921_1093181930 12 Left 1093181921 12:15976451-15976473 CCAAGAATTTCTCTAGGCCCCAG 0: 1
1: 0
2: 1
3: 16
4: 200
Right 1093181930 12:15976486-15976508 TAGGTTTCTCTCCACCTTCTTGG 0: 1
1: 0
2: 1
3: 24
4: 344
1093181921_1093181931 22 Left 1093181921 12:15976451-15976473 CCAAGAATTTCTCTAGGCCCCAG 0: 1
1: 0
2: 1
3: 16
4: 200
Right 1093181931 12:15976496-15976518 TCCACCTTCTTGGCAGTGTGTGG 0: 1
1: 0
2: 2
3: 27
4: 742
1093181921_1093181926 -7 Left 1093181921 12:15976451-15976473 CCAAGAATTTCTCTAGGCCCCAG 0: 1
1: 0
2: 1
3: 16
4: 200
Right 1093181926 12:15976467-15976489 GCCCCAGTGACATGGGGGCTAGG 0: 1
1: 0
2: 2
3: 21
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093181921 Original CRISPR CTGGGGCCTAGAGAAATTCT TGG (reversed) Intronic