ID: 1093181927

View in Genome Browser
Species Human (GRCh38)
Location 12:15976468-15976490
Sequence ACCTAGCCCCCATGTCACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 100}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093181927_1093181931 5 Left 1093181927 12:15976468-15976490 CCCCAGTGACATGGGGGCTAGGT 0: 1
1: 0
2: 1
3: 13
4: 100
Right 1093181931 12:15976496-15976518 TCCACCTTCTTGGCAGTGTGTGG 0: 1
1: 0
2: 2
3: 27
4: 742
1093181927_1093181930 -5 Left 1093181927 12:15976468-15976490 CCCCAGTGACATGGGGGCTAGGT 0: 1
1: 0
2: 1
3: 13
4: 100
Right 1093181930 12:15976486-15976508 TAGGTTTCTCTCCACCTTCTTGG 0: 1
1: 0
2: 1
3: 24
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093181927 Original CRISPR ACCTAGCCCCCATGTCACTG GGG (reversed) Intronic