ID: 1093181929 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:15976470-15976492 |
Sequence | AAACCTAGCCCCCATGTCAC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 122 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 7, 4: 114} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1093181929_1093181930 | -7 | Left | 1093181929 | 12:15976470-15976492 | CCAGTGACATGGGGGCTAGGTTT | 0: 1 1: 0 2: 0 3: 7 4: 114 |
||
Right | 1093181930 | 12:15976486-15976508 | TAGGTTTCTCTCCACCTTCTTGG | 0: 1 1: 0 2: 1 3: 24 4: 344 |
||||
1093181929_1093181931 | 3 | Left | 1093181929 | 12:15976470-15976492 | CCAGTGACATGGGGGCTAGGTTT | 0: 1 1: 0 2: 0 3: 7 4: 114 |
||
Right | 1093181931 | 12:15976496-15976518 | TCCACCTTCTTGGCAGTGTGTGG | 0: 1 1: 0 2: 2 3: 27 4: 742 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1093181929 | Original CRISPR | AAACCTAGCCCCCATGTCAC TGG (reversed) | Intronic | ||