ID: 1093181930

View in Genome Browser
Species Human (GRCh38)
Location 12:15976486-15976508
Sequence TAGGTTTCTCTCCACCTTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 344}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093181921_1093181930 12 Left 1093181921 12:15976451-15976473 CCAAGAATTTCTCTAGGCCCCAG 0: 1
1: 0
2: 1
3: 16
4: 200
Right 1093181930 12:15976486-15976508 TAGGTTTCTCTCCACCTTCTTGG 0: 1
1: 0
2: 1
3: 24
4: 344
1093181929_1093181930 -7 Left 1093181929 12:15976470-15976492 CCAGTGACATGGGGGCTAGGTTT 0: 1
1: 0
2: 0
3: 7
4: 114
Right 1093181930 12:15976486-15976508 TAGGTTTCTCTCCACCTTCTTGG 0: 1
1: 0
2: 1
3: 24
4: 344
1093181927_1093181930 -5 Left 1093181927 12:15976468-15976490 CCCCAGTGACATGGGGGCTAGGT 0: 1
1: 0
2: 1
3: 13
4: 100
Right 1093181930 12:15976486-15976508 TAGGTTTCTCTCCACCTTCTTGG 0: 1
1: 0
2: 1
3: 24
4: 344
1093181928_1093181930 -6 Left 1093181928 12:15976469-15976491 CCCAGTGACATGGGGGCTAGGTT 0: 1
1: 0
2: 0
3: 8
4: 89
Right 1093181930 12:15976486-15976508 TAGGTTTCTCTCCACCTTCTTGG 0: 1
1: 0
2: 1
3: 24
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093181930 Original CRISPR TAGGTTTCTCTCCACCTTCT TGG Intronic