ID: 1093183607

View in Genome Browser
Species Human (GRCh38)
Location 12:15994905-15994927
Sequence TGCAGTAATCCCAAGAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 187}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093183607 Original CRISPR TGCAGTAATCCCAAGAGGGA GGG Intronic
900380572 1:2381949-2381971 TGCTGTCAGCCCAGGAGGGAGGG + Intronic
902065452 1:13681915-13681937 TGCAGGAGACCCAAGAAGGAGGG + Intergenic
904538339 1:31216011-31216033 TGCAGTAAACCCAAGTGGTCTGG + Intronic
904975960 1:34456643-34456665 TGCAGTGAGCCCAAAAGGGTGGG + Intergenic
905251938 1:36654877-36654899 TGGAGTAGTCCCAATAGGGAAGG - Intergenic
905848677 1:41257190-41257212 TGCAGTCAGCCCAAGATGGAGGG + Intergenic
908502580 1:64759014-64759036 TGCAGACATCCCAAGAAAGAGGG - Intronic
909885236 1:80933575-80933597 TGCAGTAATCATAACAGAGATGG + Intergenic
912107409 1:106297181-106297203 TGCAGTAAATAGAAGAGGGATGG - Intergenic
912466279 1:109877150-109877172 TGCCATATTCCCAAGAGGGCTGG - Intergenic
913031123 1:114903604-114903626 TGTATTTATCCTAAGAGGGATGG + Intronic
915007263 1:152650209-152650231 AGCTGTAATCCCAAAAGGGTGGG + Intergenic
915214363 1:154329982-154330004 TGCAGTGGTCCCCAGGGGGAAGG + Intronic
916349617 1:163834196-163834218 GGCACTTATCCCAAGAGAGATGG - Intergenic
918850500 1:189681829-189681851 TGATGAAATCTCAAGAGGGAAGG + Intergenic
919984629 1:202664291-202664313 TGCAGGAAACCCAAGAAGGATGG - Intronic
920043303 1:203117699-203117721 TGCAGAAAGGCCAAAAGGGACGG - Intronic
924920170 1:248620596-248620618 ATCAGTAATTCCAAAAGGGAGGG - Intergenic
1064443539 10:15373261-15373283 TGCAGGAATCAGAAGAAGGAGGG - Intergenic
1067822682 10:49543762-49543784 AGCTGTATTCCCAAGAGGGCAGG - Intergenic
1067856324 10:49796707-49796729 ATCAGTAATTCCAAAAGGGAGGG + Intergenic
1068399765 10:56513212-56513234 TGAAGTAATGTCAAGAGTGAAGG - Intergenic
1069573112 10:69506564-69506586 GGCAGGAATCCCAGAAGGGAGGG + Intronic
1069852651 10:71420097-71420119 TCCAGAAATCCAAATAGGGAGGG + Intronic
1070271210 10:74956865-74956887 TAAACTAATCCCAAGAAGGAAGG - Intronic
1071505121 10:86227442-86227464 AGCAGTTAGCCCAAGAGGCAAGG - Intronic
1072905743 10:99451574-99451596 TGCACTTATGCCAAGGGGGAGGG - Intergenic
1073209303 10:101785968-101785990 TGGAGTGATTCCAAGTGGGATGG - Exonic
1074047621 10:109852848-109852870 TGCAGTATGCCCAGGTGGGATGG - Intergenic
1075893790 10:125977698-125977720 TGCAGTCAGCCCAAGATGTAGGG + Intronic
1078916125 11:15780513-15780535 TGCAGTAAACCACAGAGGGGAGG - Intergenic
1084892374 11:72242997-72243019 GGCAGTCTTCCCAGGAGGGAAGG + Intronic
1085751939 11:79169365-79169387 TTGAGTGATCGCAAGAGGGAGGG + Intronic
1086900493 11:92362017-92362039 TTCAGTCATCCCAGGAGGTATGG + Intronic
1087864380 11:103206065-103206087 TGCAGTAATCCAGAGAGAAAAGG + Intronic
1091744021 12:2979710-2979732 TGCTGTCATCTCAGGAGGGAAGG - Intronic
1092678493 12:10949235-10949257 TGCAGTCAGCCCAAGATGGAGGG + Intronic
1093183607 12:15994905-15994927 TGCAGTAATCCCAAGAGGGAGGG + Intronic
1094099352 12:26744304-26744326 TGCAGTAATGGCAAGTAGGATGG - Intronic
1095824271 12:46515707-46515729 TACAGTCAGCCCAAGATGGAGGG + Intergenic
1096258179 12:50075221-50075243 TGCAGTCATCCCATGATGCACGG - Intronic
1097519552 12:60649427-60649449 AGCAGTAATGCCAATAGGAAAGG - Intergenic
1099305698 12:80952360-80952382 TTCAGTAAACCAAAGAGAGAGGG - Intronic
1100409585 12:94301987-94302009 AGCAGTTATCCCAGTAGGGACGG - Intronic
1101630638 12:106490628-106490650 TTAAATAATCCCCAGAGGGAGGG - Intronic
1103315050 12:120046693-120046715 TGCACTAATTCCAACATGGATGG - Intronic
1103479976 12:121244614-121244636 TGCTGGAATCACCAGAGGGAGGG + Exonic
1103757935 12:123224574-123224596 TGCAGTGATCTCAATGGGGAAGG + Intronic
1104267184 12:127244522-127244544 TGGGGCATTCCCAAGAGGGAAGG - Intergenic
1105567124 13:21560675-21560697 TGCAATAATCCCAATGGGGTAGG - Intronic
1106360617 13:29027496-29027518 TGCAGTAATTCCCTGAGGGTTGG + Intronic
1107398387 13:40042638-40042660 TTCAGTAATCATAAAAGGGATGG - Intergenic
1110125827 13:71941137-71941159 TGCAAGTATCCCAAGAGAGATGG - Intergenic
1110556451 13:76865212-76865234 TGCATTTTTCCCTAGAGGGAGGG - Intergenic
1110560307 13:76904631-76904653 TGGAATAATCCCAAGAGCCAAGG - Intergenic
1112261351 13:97880891-97880913 GTTAGTAATCCCAAAAGGGAGGG - Intergenic
1113226970 13:108169464-108169486 TGCAATCATCCCAGGATGGAGGG - Intergenic
1117636943 14:57753997-57754019 TGGACTAATCCTGAGAGGGAAGG - Intronic
1118515758 14:66527028-66527050 TGCAGTAGTTCCAAAAGGAATGG + Intronic
1119471690 14:74904380-74904402 AACAGTAATTCCAAAAGGGAGGG + Exonic
1122164847 14:99814889-99814911 TGCAGTAATCCTTGGAGGGTAGG + Intronic
1122230354 14:100303852-100303874 AGAGGTAACCCCAAGAGGGAAGG - Intronic
1122412273 14:101531725-101531747 GGAAGTAAAGCCAAGAGGGAGGG + Intergenic
1202889267 14_KI270722v1_random:140450-140472 TGCACTAATCCCAATCAGGATGG + Intergenic
1123479507 15:20617942-20617964 GGCAGTAATGCCCAGATGGATGG - Intergenic
1123638500 15:22382422-22382444 GGCAGTAATGCCCAGATGGATGG + Intergenic
1124589320 15:31039568-31039590 AGCAGTAAACCCAAGAGCTAGGG + Intronic
1124668703 15:31617688-31617710 TGCAGTGATAGGAAGAGGGAAGG + Intronic
1125806259 15:42496127-42496149 TGCAGTAATGCCGCGAGGTAAGG - Intronic
1125880212 15:43186886-43186908 TGCAGTAATTCTAAGTTGGAAGG - Intronic
1125988558 15:44081129-44081151 TGAAGTGTTCCCAAAAGGGAAGG - Intronic
1129387787 15:75205390-75205412 TTCTGAAATCCCAAGAAGGAGGG + Intronic
1130620011 15:85452987-85453009 TGCAGTCAGCCCAGGATGGAGGG + Intronic
1132081367 15:98868726-98868748 TGCAACAAGCCAAAGAGGGAGGG - Intronic
1138103262 16:54271478-54271500 GGCACTAATGCCAAGAGGCAGGG - Intergenic
1138312710 16:56041815-56041837 TGGAATGATCCCAAGAGGGATGG + Intergenic
1138507279 16:57484648-57484670 TGCAGTGGTCCCTCGAGGGAGGG - Intronic
1139492525 16:67294014-67294036 TGCCGAAATGCCAAGAGGGCTGG - Exonic
1140873780 16:79131277-79131299 AGCTGTACTCCCAAGAGGCATGG + Intronic
1141392357 16:83675410-83675432 TGCAGGAAGCCACAGAGGGAGGG - Intronic
1141647689 16:85376347-85376369 TGCAGTAATCCTAACGGGCAGGG - Intergenic
1146844791 17:36175774-36175796 TCGAGTATTCCCAGGAGGGACGG - Intronic
1146857095 17:36263709-36263731 TCGAGTATTCCCAGGAGGGACGG - Intronic
1146863520 17:36324666-36324688 TCGAGTATTCCCAGGAGGGACGG + Intronic
1146873007 17:36387619-36387641 TCGAGTATTCCCAGGAGGGACGG - Intronic
1146880365 17:36438705-36438727 TCGAGTATTCCCAGGAGGGACGG - Intronic
1147066380 17:37925254-37925276 TCGAGTATTCCCAGGAGGGACGG + Intronic
1147075890 17:37988244-37988266 TCGAGTATTCCCAGGAGGGACGG - Intronic
1147077913 17:38004815-38004837 TCGAGTATTCCCAGGAGGGACGG + Intronic
1147087415 17:38067790-38067812 TCGAGTATTCCCAGGAGGGACGG - Intronic
1147093849 17:38128750-38128772 TCGAGTATTCCCAGGAGGGACGG + Intergenic
1147103359 17:38191753-38191775 TCGAGTATTCCCAGGAGGGACGG - Intergenic
1147855718 17:43478281-43478303 TACTGTAATCCCAAGACGAAGGG + Intergenic
1149847933 17:60018222-60018244 TCGAGTATTCCCAGGAGGGACGG - Intergenic
1150291023 17:63982268-63982290 TGTAGTTGTCCCATGAGGGAAGG - Intergenic
1151326723 17:73384193-73384215 TGCAGCATTCCCTAGAAGGAGGG + Intronic
1156569277 18:38234611-38234633 GACAGTAACCCTAAGAGGGAGGG - Intergenic
1157450452 18:47782824-47782846 TGCAATAGTCCAAAGATGGAAGG - Intergenic
1160246869 18:77166158-77166180 TGCATTCATCACAGGAGGGATGG + Intergenic
1160455791 18:78998680-78998702 TACAGTAAACCCAAGAGAAATGG + Exonic
1163877866 19:19890277-19890299 TGCAGTAATCCAAACAGGAATGG - Intronic
1167816687 19:51888363-51888385 TACAGGAATTTCAAGAGGGAGGG + Intronic
1202664662 1_KI270708v1_random:107219-107241 TGCACTAATCCCAATCAGGATGG + Intergenic
925555956 2:5131970-5131992 TGCAGAAACCTCAAAAGGGAGGG - Intergenic
927422120 2:22944570-22944592 TGCAGTTATACCCACAGGGAGGG + Intergenic
928603783 2:32925778-32925800 GGCAGTCAACACAAGAGGGATGG + Intergenic
929567613 2:42999604-42999626 TGGAGTCATCCCAGGAGGCAGGG + Intergenic
930345918 2:50180621-50180643 TGCTGTATCCCCCAGAGGGAAGG - Intronic
931320683 2:61172305-61172327 GGCACAAATACCAAGAGGGAGGG + Intergenic
932702988 2:74003527-74003549 TGCAGAAATCCCGGGGGGGACGG + Intronic
933626876 2:84611056-84611078 TGCAGTAATAGCAGGAGGCATGG + Intronic
936493899 2:113000417-113000439 TGCTTTACTTCCAAGAGGGAGGG + Intergenic
937336101 2:121063285-121063307 TTCTGGAATCCCAAGGGGGAAGG + Intergenic
938172793 2:129096297-129096319 AGCAGTAATCAAAAGAGAGATGG - Intergenic
938763877 2:134447688-134447710 AGCAGTCATCCCAAGTGGGAGGG + Intronic
941111340 2:161421608-161421630 TTCAGTAATCCCAAGTGGGTGGG + Intronic
943442470 2:187942990-187943012 TTCAGAATTCCCAAGAGGGTTGG - Intergenic
944299713 2:198109358-198109380 TGCAATAATATCAAGAGGTAAGG - Intronic
944458990 2:199924611-199924633 TAGAGAAATCCAAAGAGGGAGGG + Intronic
945781722 2:214183124-214183146 GGCAGTAATTCAAATAGGGATGG - Intronic
946332309 2:219017375-219017397 GGCAGGAACCCCAAGTGGGAGGG - Intronic
947254023 2:228141968-228141990 TACCGGAATCCCTAGAGGGAAGG - Intronic
1168943703 20:1734197-1734219 AGCACTGAGCCCAAGAGGGAAGG - Intergenic
1172318806 20:33979859-33979881 TGCAGTAATTCCTAGAAGGTGGG - Intergenic
1172626644 20:36351164-36351186 GGCAGTAATCCCAACAGAGTGGG - Intronic
1177242516 21:18477933-18477955 TTCCTTAATCCCAAGAGTGAAGG + Intronic
1178197655 21:30366946-30366968 TGCAGCAATCCCAAGATAGAAGG - Intronic
1179178874 21:39028607-39028629 TCCAGGCATGCCAAGAGGGAAGG - Intergenic
1180002141 21:45000034-45000056 CACAGGAAACCCAAGAGGGACGG + Intergenic
1180331392 22:11484139-11484161 TGCACTAATCCCAATCAGGATGG + Intergenic
1184149197 22:42628706-42628728 GGAAGTAGTCCCAAGAGTGAGGG - Intronic
1184844560 22:47073379-47073401 TGCAGTGTTCCAAACAGGGAAGG - Intronic
951283448 3:20780216-20780238 TGCAGTCAGCCCAAGATGGAGGG - Intergenic
957275237 3:78082425-78082447 TGCTGTAATACCAGGTGGGAGGG + Intergenic
960685311 3:120288551-120288573 TGCAATCAGCCCAAGAAGGAGGG - Intergenic
962271783 3:133982726-133982748 TGCAGTGATCTGAGGAGGGATGG - Intronic
962324951 3:134425155-134425177 TGTAGTAATGGCAGGAGGGACGG + Intergenic
962669345 3:137689431-137689453 GGCAGTAAACCAAAGAGGAAAGG + Intergenic
963607501 3:147423715-147423737 TGAAGAAATCCCAAGAGGATAGG + Intronic
965317851 3:167212602-167212624 TGCAGTTAGCCCAAGATGAAGGG - Intergenic
965509700 3:169554869-169554891 TGCAGTGATCCCGAGAGCAATGG + Intronic
966000494 3:174943665-174943687 TGCAATCAACCCAAGATGGAAGG + Intronic
969039467 4:4284049-4284071 CGCAGTAACCCTATGAGGGAAGG + Intronic
969351059 4:6598174-6598196 TGCAGCAACCCCCAGAGGGGAGG - Intronic
973305444 4:48643384-48643406 AGAAGTAATCCCAAGAGTGATGG - Intronic
973574583 4:52273888-52273910 TGCAATCAGCCCAGGAGGGAGGG - Intergenic
975936292 4:79585287-79585309 GGCAGAAATCTCAAGGGGGACGG - Intergenic
976954626 4:90880352-90880374 TGCAGTCAGCCCAGGATGGAGGG + Intronic
977394069 4:96450300-96450322 TGCAGTCATCCCAGGATGGAAGG + Intergenic
977819894 4:101458948-101458970 TGCAATCAGCCCAAGATGGAGGG - Intronic
980669917 4:135992135-135992157 TTCAGGAATCACAAGAAGGAAGG + Intergenic
989661232 5:43799937-43799959 TGCAGTGCCCCCAAAAGGGAAGG - Intergenic
990590351 5:57256292-57256314 TGGAGTAAGCTCTAGAGGGAGGG + Intronic
992733169 5:79692143-79692165 ATCAGTAATTCCAAAAGGGAGGG + Intronic
992767118 5:80011474-80011496 GGGAGCAATCACAAGAGGGAAGG + Intronic
994473374 5:100238234-100238256 TGCAGTCAGCCCAGGATGGAGGG + Intergenic
994862388 5:105214537-105214559 TGCAGCAGTCCCAGGAGTGAGGG + Intergenic
995613667 5:113937623-113937645 TTCAGTGCTCCCAATAGGGAAGG + Intergenic
999074557 5:148781743-148781765 TGCAATCATCCCAGGAGGGAGGG - Intergenic
1000111052 5:158108300-158108322 CACAGTAGTCCCAAGAGGCAGGG + Intergenic
1003097228 6:3151954-3151976 TTCAGTAATCCAAAAATGGAAGG + Intronic
1003181960 6:3799716-3799738 GGCAGTGATGCCAAGAGGCAGGG - Intergenic
1006174042 6:32111019-32111041 TGCAGTGATAGGAAGAGGGAGGG + Intronic
1006591975 6:35165001-35165023 TGCAGCAATCCCACCAGGGAGGG + Intergenic
1007426723 6:41751201-41751223 TGCAGTAATCCAAAGTGACAAGG - Intronic
1008182783 6:48353851-48353873 GACAGGAATCCCAAGAGAGAGGG + Intergenic
1009034830 6:58104330-58104352 TGCATTAATTCCAAGAGGATTGG + Intergenic
1009560071 6:65228773-65228795 TGTAGTAATCACAAGAGTGGTGG + Intronic
1013254147 6:108367400-108367422 TGCAGCAATCCCAAGGGGAGGGG + Intronic
1013986743 6:116202924-116202946 TGTAGTAATGCAAAAAGGGAGGG + Intronic
1014183327 6:118408269-118408291 TGCAATCATCCCAGGATGGAGGG - Intergenic
1016328756 6:142934247-142934269 TGCTGTATTCCCAGGAGGTAGGG + Intronic
1018176775 6:161184204-161184226 TGCAGTCAGCCCAACAGGGGTGG + Intronic
1018706963 6:166470322-166470344 TGCAGTTAACCCGGGAGGGAAGG + Intronic
1019943973 7:4312145-4312167 TGCCGTACTCCCAATAGTGAGGG + Intergenic
1020702377 7:11499251-11499273 TGTAGTCAGCCCAAGATGGAAGG - Intronic
1021973346 7:25986201-25986223 TGCAGTGAACACAAGAGCGAGGG + Intergenic
1022785104 7:33630926-33630948 GGCTGTAATCCCATGAGGGCAGG - Intergenic
1023886332 7:44359937-44359959 TGCAATCATCCCAGGATGGAGGG + Intergenic
1028274366 7:88834936-88834958 TGCAGAAATCCAAAGAGGGCTGG - Intronic
1034364309 7:150533487-150533509 TGCAATTAGCCCAAGATGGAGGG + Intergenic
1035120091 7:156559663-156559685 AACAGGAATCCCAAGAGAGAAGG - Intergenic
1038233526 8:25728914-25728936 TGCAGTCAGCCCAAGAGGGAGGG + Intergenic
1042619886 8:70693676-70693698 TGCAGTCAGCCCAAGACGGAAGG + Intronic
1044125956 8:88457873-88457895 TGCAGTCAGCCCAAGATGGAGGG - Intergenic
1044162503 8:88936356-88936378 TGCAGTCAGCCCAAGATGGAGGG - Intergenic
1044920170 8:97161905-97161927 TGAACTCATCCCAAGTGGGAAGG - Intergenic
1045013341 8:97977560-97977582 TCCAGTAATCCCAGGGAGGAAGG - Intronic
1045370186 8:101515084-101515106 TGCAGTGATCCCTATAAGGAGGG - Intronic
1046603817 8:116348611-116348633 TCCAGAGATCCCAAGAAGGATGG - Intergenic
1049113936 8:140669625-140669647 AGCAGGAAGCCCAAGTGGGAGGG - Intronic
1049995416 9:1029533-1029555 TGCTGCATACCCAAGAGGGAAGG - Intergenic
1052713297 9:32084325-32084347 TGCAATAATACCCAGAGGAATGG + Intergenic
1057104875 9:92404551-92404573 TGCATTAGCCCCAAGTGGGAGGG + Exonic
1061918038 9:133767293-133767315 AGCAGTAATCCCAAGAAAGCTGG + Intronic
1203721386 Un_GL000216v2:15860-15882 TGGAATAAACCCAAGAGGAATGG - Intergenic
1186156752 X:6733595-6733617 TGCAGGAATCCAGAGAGAGATGG + Intergenic
1188869655 X:35358840-35358862 TGCAGTCAACCCAGGATGGAAGG + Intergenic
1191155284 X:57266712-57266734 TGCAATCATCCCAGGATGGATGG - Intergenic
1192181261 X:68917148-68917170 AGCGGGAATCCCAGGAGGGATGG + Intergenic
1192254292 X:69442813-69442835 TGCAGTCAGCCCAAGATGGAGGG + Intergenic
1193739622 X:85202681-85202703 TGCAGTCAGCCCAAGATGGAGGG + Intergenic
1193858979 X:86640461-86640483 TCCAGTCAGCCCAAGAGAGAAGG - Intronic
1194854647 X:98914592-98914614 TGCAGTCATCCCAGGATGAAGGG + Intergenic
1195566573 X:106346037-106346059 ATCAGTAATTCCAAAAGGGAGGG + Intergenic
1196227900 X:113188413-113188435 TGCAGTCAGCCCAGGATGGAGGG + Intergenic
1196494235 X:116306111-116306133 GAAAGTAATCCCAGGAGGGATGG - Intergenic
1196932672 X:120696655-120696677 TGCAGTCAGCCCAAGATGGAGGG - Intergenic
1197390082 X:125852268-125852290 TGGAATAATCACAAGAGGAATGG - Intergenic
1201550699 Y:15213735-15213757 TGCAGGAATCCAGAGAGAGATGG + Intergenic