ID: 1093184361

View in Genome Browser
Species Human (GRCh38)
Location 12:16002991-16003013
Sequence CACCCAGTTTGTGGTGATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 119}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093184361_1093184366 14 Left 1093184361 12:16002991-16003013 CCCTTATCACCACAAACTGGGTG 0: 1
1: 0
2: 1
3: 14
4: 119
Right 1093184366 12:16003028-16003050 AATTTATCTGAGAGTTCTGAGGG 0: 1
1: 1
2: 6
3: 53
4: 457
1093184361_1093184365 13 Left 1093184361 12:16002991-16003013 CCCTTATCACCACAAACTGGGTG 0: 1
1: 0
2: 1
3: 14
4: 119
Right 1093184365 12:16003027-16003049 AAATTTATCTGAGAGTTCTGAGG 0: 1
1: 1
2: 4
3: 34
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093184361 Original CRISPR CACCCAGTTTGTGGTGATAA GGG (reversed) Intronic
901244419 1:7718069-7718091 GACCGAGTTTCTGGTGACAAAGG + Intronic
905706109 1:40059903-40059925 CAACCAGTTAGTGGTGATACTGG + Intronic
906049793 1:42860726-42860748 CACCTAATTTGGGGTGCTAATGG + Intergenic
906742425 1:48195869-48195891 TTCCCAGTCTCTGGTGATAAGGG - Intergenic
908386356 1:63645925-63645947 CACACAGTTAGTGGGGAGAAAGG + Intronic
909809059 1:79907704-79907726 CTCCAAGTCTTTGGTGATAAGGG + Intergenic
910752109 1:90642805-90642827 CACTCTGATTGTTGTGATAATGG + Intergenic
912854294 1:113153372-113153394 CCCCCAGCTTGTGGGGAGAAGGG - Intergenic
915214634 1:154331663-154331685 TAACCAGTTTGTGGCGGTAAGGG + Exonic
923031695 1:230254193-230254215 CACCTAGTCAGTGGTGATAAGGG + Intronic
1065509885 10:26467950-26467972 CACTCAGTAAGTGGTGATAGCGG - Intronic
1065515111 10:26516974-26516996 TTCCCAGTCTCTGGTGATAAGGG + Intronic
1072078213 10:92000483-92000505 CATCCACTGTGAGGTGATAAAGG + Intronic
1072457500 10:95589583-95589605 CAGCCATTTTGTGGTCACAAGGG - Intergenic
1075285261 10:121179333-121179355 CACCCAGATTGTGGTTCTATTGG - Intergenic
1075869085 10:125755344-125755366 ATCCCAGTTTGTTGTGATGAAGG + Intronic
1075973261 10:126672971-126672993 CAGCCAGCCTGTGGTGATTATGG + Intergenic
1078021319 11:7657863-7657885 CTCCAAGTTTGTGGTGAGGACGG - Intergenic
1079471540 11:20782845-20782867 CACCCAGTTTATCATGACAAGGG + Intronic
1079622511 11:22571550-22571572 CAACCTGTTTGTGCTGATATAGG - Intergenic
1081273233 11:41113424-41113446 CACACAGTTTGGAGGGATAATGG + Intronic
1081896728 11:46593558-46593580 CCCCCAGTGTGTGGCGAAAATGG - Intronic
1086773437 11:90798339-90798361 CTCCCAGTCTCTGGTGATAAGGG + Intergenic
1088030358 11:105241006-105241028 TAACCAGTTTGAGGTGGTAAAGG + Intergenic
1088699937 11:112402864-112402886 CCCCCAGTTTTATGTGATAATGG + Intergenic
1091634507 12:2186956-2186978 CAGCCAGTTTGTGGGGAAAGGGG - Intronic
1092585396 12:9895727-9895749 CACCCAGTTTCCTGTGATAACGG - Exonic
1093184361 12:16002991-16003013 CACCCAGTTTGTGGTGATAAGGG - Intronic
1095297939 12:40548391-40548413 CACCAAGTTTATAGTGAGAATGG + Intronic
1097589818 12:61560954-61560976 CACCCAGTTTGTGATGACTGTGG + Intergenic
1101001780 12:100364160-100364182 CACCCAATTTATGGTGAAGATGG - Intronic
1103222301 12:119255921-119255943 CACCTAGTATGTGCTTATAAGGG - Intergenic
1107488876 13:40860364-40860386 CACCCAGGTTATGGTGTTTATGG - Intergenic
1113807325 13:113117513-113117535 CACCCAGATGGTGTTGATCAGGG - Exonic
1114628710 14:24146333-24146355 AAGCTAGTTTGTGGTGAGAAAGG - Intronic
1117984598 14:61374775-61374797 CTCCCAGTCTGTGATGAGAAGGG + Intronic
1117992159 14:61444695-61444717 CACCCAGTTGGTGATGAGACTGG - Intronic
1118283417 14:64449607-64449629 CACCCACCTTGAGGTCATAAAGG - Exonic
1120194014 14:81463618-81463640 CACCAAGTTTGTGGTGTAATTGG - Intergenic
1121429693 14:93878218-93878240 CTCCGAGTAGGTGGTGATAAAGG + Intergenic
1124457212 15:29854663-29854685 CACCAAGTGTGTGGTGATTTAGG + Intronic
1127215050 15:56815423-56815445 CACCCAGTTTCTGGGGATTACGG - Intronic
1127726956 15:61759765-61759787 CACCCAGCTTGAGGTGACAAAGG - Intergenic
1127845625 15:62868112-62868134 CACCCAGTCTGTGATGCTATGGG + Intergenic
1130872041 15:87979184-87979206 CACCCATCTGGTGGTGTTAAAGG + Intronic
1131159202 15:90093456-90093478 CAACTAACTTGTGGTGATAAAGG + Intronic
1133943854 16:10332397-10332419 TTCCCAGTCTCTGGTGATAAGGG + Intronic
1134427939 16:14170366-14170388 CACCCAGATTGTGGTTGCAAGGG - Intronic
1135396334 16:22134498-22134520 CACCCAGTTTGTGGCAGTTATGG - Intronic
1137921002 16:52488373-52488395 GACACAGCTTGTGTTGATAATGG + Intronic
1138134683 16:54511556-54511578 CAACCAGTGAGTGGTGATATGGG - Intergenic
1138949243 16:61890893-61890915 CACCCAGCTTATGTTGATAATGG + Intronic
1139576137 16:67843232-67843254 CCCCCAGTTGGTGGTGGTAGGGG + Exonic
1139768612 16:69254153-69254175 CACCCAGTTTGGTGGGATGAGGG + Intronic
1142017274 16:87756555-87756577 CAGCCAGTTTGTGGTGACAGAGG - Intronic
1146754022 17:35410108-35410130 CACACAGTGTGTGATGATGATGG + Intergenic
1148792848 17:50183386-50183408 CACCCAGTCCGTGGTGAGCAGGG + Exonic
1151027339 17:70693835-70693857 CAGCCAGGTTGTGGAGAAAAGGG - Intergenic
1155199154 18:23502705-23502727 CTCCCAGTCTCTGGTGATAAGGG - Intergenic
1157527117 18:48392208-48392230 CACCCAATGTGTGGTGGGAAGGG - Intronic
1157976459 18:52333166-52333188 CAAAGAGTTTGAGGTGATAATGG - Intergenic
1158246290 18:55435907-55435929 CTCCAAGTATGTGGTGATAAAGG + Intronic
1160342974 18:78105465-78105487 TTCCCACTTTGTGGTGATACTGG + Intergenic
1164977742 19:32586565-32586587 CACTCAGCTAGTGATGATAAAGG + Intronic
1167211819 19:48138271-48138293 CACACAGTATCTGGTGACAAGGG - Intronic
1167666933 19:50827688-50827710 CACCCAGTGTGGGGAGATGAGGG + Exonic
929557341 2:42933930-42933952 CACCCAGTTGGTGCTGGAAAAGG + Intergenic
933987670 2:87605537-87605559 GATAGAGTTTGTGGTGATAAAGG + Intergenic
936306170 2:111345271-111345293 GATAGAGTTTGTGGTGATAAAGG - Intergenic
941940094 2:171026636-171026658 TAACCAGCCTGTGGTGATAAAGG - Intronic
945151825 2:206799750-206799772 CTCCAAGTCTCTGGTGATAAGGG + Intergenic
946611731 2:221465760-221465782 CATCCAGTTGGTGGTGATGGGGG - Intronic
1170519037 20:17163863-17163885 CACCCATTTTGTTATGATTATGG - Intergenic
1174284303 20:49461379-49461401 CACTCAGGTCGTGCTGATAAGGG - Intronic
1174904914 20:54540222-54540244 CACCAGGTCTGTGGTCATAATGG - Intronic
1175098306 20:56559589-56559611 CACCCAGTTTGTGGTACTTTAGG - Intergenic
1175828344 20:61949220-61949242 CACATAGTTAGTGTTGATAATGG - Intergenic
1178750613 21:35299217-35299239 CACCCAGTTTGTGGTACTCTGGG + Intronic
1179074026 21:38101087-38101109 CCCCCAATTTGTGGAGATGAAGG + Intronic
1179252194 21:39680440-39680462 CACTGAGTTTGTGGTGATGCTGG + Intergenic
1183865499 22:40701053-40701075 CTTCCAGTCTCTGGTGATAAGGG - Intergenic
952589932 3:34939624-34939646 CACCTAGGTTGTGGTTACAAAGG + Intergenic
953897185 3:46811743-46811765 TACCCAGTGTCTGGCGATAAGGG + Intronic
954454982 3:50592911-50592933 CACCCAGTTGATGGTGCTCAGGG - Intergenic
955291425 3:57695855-57695877 CACACAGTTTCTGTTGTTAATGG + Intergenic
955455607 3:59117770-59117792 CACCCAGTCTATGGTATTAATGG + Intergenic
956958299 3:74367606-74367628 CAGCCATTTTGTGATCATAATGG + Intronic
960287205 3:115843148-115843170 TACCTGGGTTGTGGTGATAAGGG - Intronic
962266070 3:133945168-133945190 CACCCGGTCTGTGGAGACAATGG - Exonic
962422896 3:135243662-135243684 CACCAAGTTGGTGGTGGTAAAGG + Intronic
967297597 3:187980394-187980416 AACCCAGTTAGGGGTGAAAATGG - Intergenic
968171299 3:196512118-196512140 CACCTAGATTGTGGTTATGAGGG + Intronic
969692075 4:8709300-8709322 CCCCCAGTTTGTGGTTATTATGG + Intergenic
970501351 4:16680272-16680294 CACCCAGTTTATGGTGTTCTTGG + Intronic
971501562 4:27324051-27324073 TTCCCAGTCTCTGGTGATAAGGG - Intergenic
982631896 4:157840839-157840861 TTCCCAGTCTCTGGTGATAAGGG - Intergenic
987012164 5:13778642-13778664 CACCCAGCTTCTTGTGATATGGG + Intronic
991516806 5:67445210-67445232 CAACCAGTTTTTGGTGCCAAGGG - Intergenic
991536138 5:67671169-67671191 CTCCCTGTTTGTTGTGATCAAGG + Intergenic
992399886 5:76402772-76402794 CACTCAGTTTCTTGTCATAAGGG + Intergenic
995097052 5:108249158-108249180 TACCCATTTTCTGGTGAAAAGGG - Intronic
999132830 5:149297587-149297609 CAACGAGTTTGGGGTGATGATGG + Intronic
1001085661 5:168698612-168698634 CACCCAGTCTGTGGTTATTATGG + Intronic
1001345758 5:170896931-170896953 GACCCAGTTGGTGGTCATACTGG + Intronic
1007479440 6:42140581-42140603 AAACCAGATGGTGGTGATAATGG + Intronic
1010028686 6:71249322-71249344 CACCCAGATTGAGTTGAAAAAGG + Intergenic
1013445430 6:110221369-110221391 CACCCAGATTGTCCTGACAATGG - Intronic
1015367512 6:132413706-132413728 AACCCAGCTTGTGATGATAGTGG + Intergenic
1015655656 6:135515492-135515514 AACCCAGTAAGTGGTTATAAAGG - Intergenic
1016325223 6:142893161-142893183 CAGCAAGTTTGTGGTGGAAAAGG - Intronic
1017313606 6:153002752-153002774 CACCCAGAATTTGGAGATAAGGG + Intergenic
1017875355 6:158519856-158519878 CACCCAGTGTGTGGTGTTCTGGG + Intergenic
1018141066 6:160837726-160837748 CACCCAGTTTGGGGTGGAAGAGG + Intergenic
1026778245 7:73245466-73245488 TGCCTGGTTTGTGGTGATAATGG + Intergenic
1027068929 7:75147077-75147099 TGCCTGGTTTGTGGTGATAATGG - Intronic
1027503429 7:78984381-78984403 CACATAGGCTGTGGTGATAAAGG - Intronic
1028972243 7:96872019-96872041 CACACAGTTTGTGATGATTTGGG - Intergenic
1031729434 7:125280044-125280066 CACCCAGTTTGTCGTTTTCAGGG + Intergenic
1039934033 8:42024219-42024241 CAGCATGTTTGTGGTGATATTGG - Intronic
1040386279 8:46916907-46916929 CACCCAGCTAGTGGTGACAGTGG - Intergenic
1043928537 8:86065008-86065030 CACCCAGATTGTGGTTGGAATGG + Intronic
1044420053 8:91984260-91984282 CACACAGATTCTGGTGATATAGG - Intronic
1045113564 8:98956496-98956518 CAGCCATTTTGTGGCCATAAAGG - Intergenic
1047626920 8:126665888-126665910 CACCCAGTTTGTGGTAATTACGG + Intergenic
1049265036 8:141663325-141663347 CACCCAGTTTGTGGTAACTGTGG - Intergenic
1050823658 9:9915063-9915085 AAGAGAGTTTGTGGTGATAATGG - Intronic
1053193985 9:36100709-36100731 CAGCCAGTAGGTGGTGATGAGGG - Intronic
1054751079 9:68906778-68906800 CACTGAGTTGGTCGTGATAATGG - Intronic
1056592130 9:87972305-87972327 GACCCAGTTTGTGGGGATCTGGG + Intronic
1058545947 9:106060146-106060168 CACCCAGTTTGTGGTACTGATGG - Intergenic
1060877024 9:127090819-127090841 CACCCAGTTTCTTGAGATGAAGG - Intronic
1061864206 9:133484139-133484161 CACCCTGCTTGTGGGGATCATGG + Intergenic
1189158259 X:38782550-38782572 CACCACGTTTGTGGTGATGCTGG - Intergenic
1189675978 X:43461017-43461039 TTCCCAGTCTCTGGTGATAAGGG - Intergenic
1199549790 X:149046520-149046542 CTCCCAGTTTTTGCTGATTATGG + Intergenic