ID: 1093185066

View in Genome Browser
Species Human (GRCh38)
Location 12:16010500-16010522
Sequence CTGCTTTTGTTGAGGAATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 272}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093185062_1093185066 -6 Left 1093185062 12:16010483-16010505 CCCTTTGCCAGCATATACTGCTT 0: 1
1: 0
2: 0
3: 25
4: 191
Right 1093185066 12:16010500-16010522 CTGCTTTTGTTGAGGAATCAAGG 0: 1
1: 0
2: 0
3: 26
4: 272
1093185060_1093185066 12 Left 1093185060 12:16010465-16010487 CCGAGTTCTGCTGCTTTCCCCTT 0: 1
1: 0
2: 5
3: 56
4: 454
Right 1093185066 12:16010500-16010522 CTGCTTTTGTTGAGGAATCAAGG 0: 1
1: 0
2: 0
3: 26
4: 272
1093185059_1093185066 28 Left 1093185059 12:16010449-16010471 CCATAGATGAGGTTTTCCGAGTT 0: 1
1: 0
2: 0
3: 3
4: 94
Right 1093185066 12:16010500-16010522 CTGCTTTTGTTGAGGAATCAAGG 0: 1
1: 0
2: 0
3: 26
4: 272
1093185058_1093185066 29 Left 1093185058 12:16010448-16010470 CCCATAGATGAGGTTTTCCGAGT 0: 1
1: 0
2: 0
3: 4
4: 52
Right 1093185066 12:16010500-16010522 CTGCTTTTGTTGAGGAATCAAGG 0: 1
1: 0
2: 0
3: 26
4: 272
1093185061_1093185066 -5 Left 1093185061 12:16010482-16010504 CCCCTTTGCCAGCATATACTGCT 0: 1
1: 0
2: 2
3: 13
4: 204
Right 1093185066 12:16010500-16010522 CTGCTTTTGTTGAGGAATCAAGG 0: 1
1: 0
2: 0
3: 26
4: 272
1093185063_1093185066 -7 Left 1093185063 12:16010484-16010506 CCTTTGCCAGCATATACTGCTTT 0: 1
1: 1
2: 0
3: 17
4: 211
Right 1093185066 12:16010500-16010522 CTGCTTTTGTTGAGGAATCAAGG 0: 1
1: 0
2: 0
3: 26
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093185066 Original CRISPR CTGCTTTTGTTGAGGAATCA AGG Intronic
900748116 1:4375078-4375100 CTACTTCTGATGAGGCATCAGGG + Intergenic
900823499 1:4908342-4908364 CTGCTTTTCTTGATGTATGACGG + Intergenic
901786639 1:11629303-11629325 CTGCTTTTGCAGAGGAGTCCTGG + Intergenic
904007263 1:27369914-27369936 CTGCTTTGGAAGAGGAACCACGG - Intronic
904585548 1:31577792-31577814 CTGCCTTTGCTGAGGATTCTAGG + Intronic
905497481 1:38403950-38403972 CTGCTTTTGTGGAGGTAGCAGGG - Intergenic
905933146 1:41803790-41803812 CTCCCCTTGTTGAGGGATCACGG + Intronic
907479089 1:54731679-54731701 CTGCTTTTCATGAGGACTCCAGG + Exonic
907629324 1:56064074-56064096 CTGCTTTTCTAGAGAAATCAAGG + Intergenic
907657534 1:56359555-56359577 CTGCTTCTGTGGAGGCCTCAGGG - Intergenic
907950080 1:59174434-59174456 CTGATTTTATTGTGTAATCAGGG + Intergenic
909322890 1:74312375-74312397 ATGCTTTTGTTCAGGATACAGGG + Intronic
910202061 1:84709908-84709930 CTGCTTAGGTTCAGGAATCATGG - Intergenic
910346763 1:86247873-86247895 CTGCTTTTCTTGTGGAAGCCTGG - Intergenic
911116571 1:94251782-94251804 CTGTTTTTATGGAGGAGTCAAGG - Intronic
911704606 1:100997002-100997024 CTGCTTTTGTTAATGGAGCAAGG + Intronic
912071714 1:105818778-105818800 CTGATCATGTTGAGGAATTAGGG - Intergenic
912612392 1:111061765-111061787 CTGCTTCAGTGGAGGAAGCAGGG + Intergenic
913283059 1:117203751-117203773 GTGCTTTTCTGGAGGAATCAGGG + Intronic
913693309 1:121300278-121300300 CTGCTTCTGGTGAGGCCTCAGGG + Intronic
915529283 1:156494111-156494133 GTGCTTTTGGTGAGGGATGATGG - Intronic
915728495 1:158036002-158036024 CTGCATTTGTTGAGAATTGAAGG - Intronic
916174319 1:162024810-162024832 CTTCTTATGCTGAGGAATAAGGG + Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
918429218 1:184441036-184441058 CTCCTTTTGGAGAGGCATCACGG + Intronic
919035562 1:192304152-192304174 CTGCTTTTGTTTTACAATCAGGG + Intergenic
919849873 1:201665411-201665433 CTGCCTTTGCTGAGGGCTCATGG + Intronic
920545239 1:206810972-206810994 CTGCTTCTGGTGAGGGATCCAGG - Intronic
921079566 1:211727694-211727716 CTACTTCTGGTGAGGACTCAGGG - Intergenic
922067383 1:222157452-222157474 CTGCATTTGTGGGTGAATCAAGG - Intergenic
922244615 1:223783392-223783414 CTGCTGTTGGTGAGGAAGTAAGG - Intronic
922862252 1:228829576-228829598 CTGCTTCTGGTGAGGACTCAGGG + Intergenic
922908807 1:229198145-229198167 CCCCTTTTGTTCAGGATTCAGGG + Intergenic
922925708 1:229345128-229345150 CTGCTTCTGGTGAGGCCTCAGGG - Intergenic
923079628 1:230641473-230641495 CCGCTTCTGTTGAGGAATCTAGG - Intergenic
1064500740 10:15970458-15970480 CTACTTTTTTTGAAGAGTCAAGG + Intergenic
1064851961 10:19718344-19718366 CAGCTCCTGTGGAGGAATCAGGG + Intronic
1065844226 10:29731806-29731828 CTGCCTTTGTTCAGTAAACAAGG - Intronic
1066027629 10:31379226-31379248 ATGCTTTTGTTGAGAAATGGAGG + Intronic
1066243694 10:33561857-33561879 GTCCTATTGTTGAGTAATCAGGG + Intergenic
1066750571 10:38652168-38652190 CTGCTTTTGGTGAAGAAAAAAGG + Intergenic
1066966479 10:42270944-42270966 CTGCTTTTGGTGAAGAAAAAAGG - Intergenic
1070480739 10:76880350-76880372 CTCCTTGTGTTGAGGCAGCATGG - Intronic
1070537623 10:77391471-77391493 CTGGCTTTCTTAAGGAATCAGGG - Intronic
1071990267 10:91094421-91094443 CTGCTTCTGGGGAGGACTCAGGG + Intergenic
1073676047 10:105648182-105648204 CTGCATTTTTTGAGGAAGAAAGG - Intergenic
1074640440 10:115372735-115372757 CTGCTTTTGTGCTGGTATCATGG + Intronic
1074737788 10:116453754-116453776 CTGCTTCTGGTGAGGCCTCAGGG - Intronic
1074944032 10:118263788-118263810 GTGCATTTGTTGTAGAATCAAGG - Intergenic
1075965387 10:126606763-126606785 CTGCTTTTGTTGGGGTATTTTGG + Intronic
1076656825 10:132029805-132029827 CTGCTTTGCTTGAAGACTCACGG + Intergenic
1077380077 11:2229183-2229205 ATGCTTTTGTGGAGGGATGATGG - Intergenic
1077845068 11:6014513-6014535 CTGCTTCTGGTGAGGACTCAGGG - Intergenic
1077845306 11:6016256-6016278 CTGCTTCTGGTGAGGCTTCAGGG - Intergenic
1078911523 11:15737044-15737066 CTGATGTTTATGAGGAATCAAGG - Intergenic
1078951294 11:16137618-16137640 CTGCTTACCTTAAGGAATCAAGG + Intronic
1080155830 11:29109621-29109643 CAGCTTTTGCTGTGGAATCCAGG + Intergenic
1080170045 11:29290103-29290125 ATGCTTTTGAAGAGGAATTATGG + Intergenic
1080376069 11:31713612-31713634 CTCTTTTGGTTGAGGAAACATGG - Intronic
1080878759 11:36300246-36300268 CAGCTTTTGGTGAGGCCTCAGGG + Intronic
1081044941 11:38261683-38261705 CTGCTTATGGTGAGGAATTCAGG - Intergenic
1082103307 11:48192437-48192459 CTGCTTCTGTTGAGGGCTCCTGG + Intergenic
1083545513 11:63546114-63546136 CAGCTTTTGTTGAGCGTTCACGG - Intronic
1085191911 11:74633690-74633712 CTGCAATTGTTGAGAAATGATGG + Intronic
1086565038 11:88215957-88215979 CTGCTTCTGGTGAGAACTCAGGG - Intergenic
1087228867 11:95636868-95636890 GTACTTGTGTAGAGGAATCAGGG + Intergenic
1088679604 11:112227558-112227580 CTGCTTCTGTTGAGGCCTCAGGG + Intronic
1090184969 11:124732121-124732143 CTGCTGTTTATGAGGAATTAAGG - Intergenic
1091091640 11:132776647-132776669 CTGCTTCTGGTGAGGCCTCAGGG - Intronic
1091465061 12:677059-677081 CAGTTTTCGTTGAGGAATTAAGG - Intergenic
1093063392 12:14630939-14630961 CTGATTGTGTGGAGGAATCCTGG + Intronic
1093185066 12:16010500-16010522 CTGCTTTTGTTGAGGAATCAAGG + Intronic
1093662868 12:21776710-21776732 CTTCTTTTGTTGAGCATTTAAGG - Intergenic
1093747578 12:22760800-22760822 GTGCTTTTGGGGAGGATTCAAGG - Intergenic
1094193660 12:27723027-27723049 GTGCTTTTTTGGAGGAAGCATGG + Intronic
1095856771 12:46868569-46868591 CAGCTTTTATTTAAGAATCAAGG + Intergenic
1098157439 12:67614265-67614287 CTTCTTTTAGTGAGGAATCAAGG - Intergenic
1099543229 12:83941619-83941641 CTGCTTCTGGTGAGGACTTATGG + Intergenic
1099922780 12:88979968-88979990 TAGCTTTTGGTGAGGCATCAGGG - Intergenic
1100448358 12:94681764-94681786 CTGCTTTTGGGGAGGTCTCAGGG - Intergenic
1104190430 12:126477263-126477285 CTGCTTCTGGTGAGGCCTCAGGG + Intergenic
1104588669 12:130067294-130067316 CTGCTTCTGGTGAGGCCTCAGGG - Intergenic
1105615447 13:22007927-22007949 CTGCTTCTGGTGAGGCCTCAGGG - Intergenic
1105970594 13:25426227-25426249 CTGCTTCTGGTGAGGCCTCAGGG + Intronic
1108491803 13:50989679-50989701 CTTCTATTGTGGAGGAGTCAGGG - Intergenic
1109856208 13:68131322-68131344 CTGCTTCTGGGGAGGATTCATGG + Intergenic
1109977222 13:69854251-69854273 CTGCTTATGTTGAGGACTTCAGG + Intronic
1110401812 13:75100853-75100875 CTGCTTCTGGTGAGGACTCAAGG + Intergenic
1110685321 13:78365888-78365910 CTTCTTTTGTTGTGTAATTAAGG - Intergenic
1111614701 13:90648384-90648406 CTGCTTCTGGTGAGGCCTCAAGG + Intergenic
1113508610 13:110833474-110833496 TTGCTTTTGATGAAGAGTCAAGG + Intergenic
1114431478 14:22665389-22665411 CTGCTTCTGCTGAGGCTTCAAGG + Intergenic
1115715133 14:36095039-36095061 CTCCTTTTGTTGAAAAATAAAGG - Intergenic
1118688895 14:68319105-68319127 CTGCATTTGTTGAGAAGTAAGGG + Intronic
1118935595 14:70284990-70285012 CTGCTTTTGGGGAGGCCTCAGGG + Intergenic
1121589152 14:95087166-95087188 CTGCTTTGGTTCATGAATCCAGG - Exonic
1123087669 14:105724369-105724391 CTGCTTCTGGTGAGGCCTCAGGG - Intergenic
1124621105 15:31274534-31274556 CAGCTGATGTTGAGGAAACATGG + Intergenic
1126673041 15:51133872-51133894 CTGCTTTTGTTTAATAATAAGGG - Intergenic
1126830552 15:52598997-52599019 CTGCTTCTGATGAGGCCTCAGGG - Intronic
1129328015 15:74812328-74812350 ATGCTTTTGTTGAGGAAACCAGG + Intergenic
1130052315 15:80494014-80494036 CTGCTTCTGGTGAGGACTCCAGG - Intronic
1133558043 16:6924292-6924314 CTGCTTCTGGTGAGGCCTCAGGG + Intronic
1133747873 16:8701237-8701259 CTGCTGTTGTTAAAGAATTAAGG - Intronic
1137439706 16:48487608-48487630 CTACTTGTGGTGAGGAAGCAAGG - Intergenic
1137624352 16:49898257-49898279 CTGCTTTTGTGGAGCAAGAAGGG - Intergenic
1139280722 16:65768107-65768129 CTGCTTTTAATGAGCAATCAGGG - Intergenic
1139717710 16:68826835-68826857 GTGTTCTTGTTGATGAATCATGG + Intronic
1140171461 16:72609238-72609260 CTGCTTTAGTTCAGGCATCCTGG - Intergenic
1141041364 16:80675543-80675565 CTGCTTTGTGTGAGGAGTCAGGG + Intronic
1142628536 17:1208113-1208135 CTGCTCTTGTCTAGGAATGAGGG + Intronic
1143858787 17:9872800-9872822 CTGCTTATTATGAGGATTCAAGG + Intronic
1144204162 17:12967455-12967477 CTGTCTTTGTTGAGGAATTGAGG - Intronic
1145023846 17:19453069-19453091 CTGCTTCTGGTGAGGCCTCAGGG - Intergenic
1145276133 17:21431937-21431959 CTGCTTCTGGTGAGGCCTCAAGG - Intergenic
1146956222 17:36937695-36937717 CTGCTTTTGTCGGGGTATGAGGG - Exonic
1147055227 17:37828959-37828981 CTGCTTCTGGTGACGAAACAGGG + Intergenic
1149084588 17:52699913-52699935 CTCCTGTTGGTGAGGAATGAGGG - Intergenic
1153141049 18:1972995-1973017 TTGCGTATGTTTAGGAATCATGG + Intergenic
1153276117 18:3369285-3369307 CTGCTTTTGGTGAGGGCTCCAGG - Intergenic
1153277523 18:3382252-3382274 CACCTTTTGTTGAAGAATCCTGG - Intergenic
1153862693 18:9229944-9229966 CTTCTCTGGTTGTGGAATCAGGG + Intronic
1155061668 18:22234165-22234187 CTGCTTTTTGTGAGGCATCGTGG + Intergenic
1157840630 18:50955116-50955138 CTGCTCTTGCTGAGGTATCTAGG - Intergenic
1161555432 19:4939516-4939538 CTTAATTTGTTGAGGAATCCTGG + Intronic
1162584989 19:11553102-11553124 TTGCTTTTGTAGAGGAAGCAAGG - Exonic
1162784788 19:13027839-13027861 CTGCTTTTGTAGAGGAGACTCGG - Intronic
1163340507 19:16703469-16703491 CAGTTTCTGTTGAGGAAACATGG - Intergenic
1166449673 19:42887585-42887607 CTGCTTCTGGTGAGGCCTCAGGG - Intronic
1166460972 19:42987888-42987910 CTGCTTCTGGTGAGGCCTCAGGG - Intronic
1166478262 19:43147870-43147892 CTGCTTCTGGTGAGGCCTCAGGG - Intronic
925400885 2:3571860-3571882 CTGCTTTTGTGTAAGAATGAAGG + Intergenic
925600049 2:5598903-5598925 CTGCTTTTGTTGGTGAAACAAGG + Intergenic
928571617 2:32615019-32615041 CTGCTTCTGTAGAGGCCTCAAGG + Intronic
928913418 2:36446010-36446032 CTGATTATGTGGAGAAATCAGGG + Intronic
929326212 2:40614543-40614565 CTGCTTCTGGTGAGGCCTCAGGG + Intergenic
929416848 2:41751684-41751706 CTGCTTTTGTGTGGGAATGAAGG + Intergenic
933373263 2:81445080-81445102 CTGCTCATGTTCAGGAATTAAGG + Intergenic
933601746 2:84339154-84339176 CTGCTTTTATTGATTAATGAGGG - Intergenic
934313571 2:91894325-91894347 CTGCTTTTGGTGAAGAAAAAAGG + Intergenic
936701115 2:115012438-115012460 CTGCTTTGGTGGAGGCAGCAGGG - Intronic
937345475 2:121122941-121122963 CTGCTTTTGTTGTAGAAACAGGG + Intergenic
937707070 2:124933328-124933350 CTGCTGTTGATGTGGAATCAGGG - Intergenic
938045056 2:128111346-128111368 CTGTTTTTGTTTTGGAGTCAGGG - Intronic
938760696 2:134423245-134423267 CCTCTTTTGTAGAGGAAGCAGGG - Intronic
938996440 2:136683567-136683589 CTGCTTTGGTGGAGGTAGCAGGG - Intergenic
941085800 2:161116200-161116222 CTGCTTATTTTGAGAAATAAAGG + Intergenic
941570714 2:167166571-167166593 CTGCTTCTGGTGAGGGCTCAGGG + Intronic
942952719 2:181739059-181739081 CTGCTTCTGGTGAGGCCTCAGGG - Intergenic
943893395 2:193320828-193320850 CTGCTTTTGGGGAGGCCTCAGGG - Intergenic
944491676 2:200263841-200263863 CTGCTTTTGTGGAGGCCTCAGGG - Intergenic
944763198 2:202838817-202838839 CTGCTTCTGATGAGGCCTCAGGG + Intronic
946049458 2:216849893-216849915 ATGTTTTTGTTGAGGAAACTGGG + Intergenic
946358385 2:219203779-219203801 CTTCTTTTATTCAGGAAGCAAGG + Intronic
946739252 2:222785588-222785610 CTGCTGTTGCTGAGAAATCTCGG - Intergenic
948576779 2:238956896-238956918 CTGCTCTGGTGGAGGAAGCAGGG - Intergenic
1169376962 20:5073936-5073958 CAGCTTCTGGTGAGGACTCAGGG + Intronic
1169666749 20:8045806-8045828 ATGTTTTTGTTGTAGAATCAAGG - Intergenic
1170054210 20:12181487-12181509 CTTCATTTTTTGAAGAATCATGG - Intergenic
1170086308 20:12535902-12535924 CTGCTTTGGTGGAGGTAGCAGGG - Intergenic
1171433083 20:25098642-25098664 GTGCTTTTCTGGAGGAATCAGGG - Intergenic
1172439694 20:34956628-34956650 CTGCCTTTCTGAAGGAATCAGGG + Intergenic
1172645605 20:36467402-36467424 CTAGTTTTGCTGAGGCATCAGGG + Intronic
1177290319 21:19103106-19103128 CTGCTTCTGGTGAGGCCTCAGGG - Intergenic
1179330313 21:40394567-40394589 CTGCCTTGGTTGAAGACTCAGGG - Intronic
1179380964 21:40898496-40898518 CTGCTTCTGGTGAGGCCTCAGGG - Intergenic
1180540311 22:16440229-16440251 CTGCTTTTGGTGAAGAAAAAAGG + Intergenic
1182659674 22:31916405-31916427 CAGCTTTCTTTGAGGGATCATGG + Intergenic
1182805220 22:33064086-33064108 CTGATTTGGTTGGGGCATCAGGG - Intergenic
950008367 3:9705310-9705332 CTCCTTTTGGGGAGGAGTCAGGG - Intronic
951243795 3:20316896-20316918 CTGATTGAATTGAGGAATCAGGG + Intergenic
951545265 3:23818542-23818564 GTAATTTTGCTGAGGAATCACGG - Intronic
952082927 3:29782285-29782307 CTGCTTTGGTGGAGGTAGCAGGG - Intronic
953910149 3:46888753-46888775 CTACTTGGGTTGAGGAATCAAGG - Intronic
954472122 3:50707116-50707138 CTGCTTCTGGTGAGGCCTCAGGG - Intronic
955495992 3:59532928-59532950 CTGCTTCTGCTGAGGAGGCATGG + Intergenic
956700903 3:71957603-71957625 CTGCTTCTGGTGAGGCCTCAGGG + Intergenic
956989452 3:74746687-74746709 CTGCTTTTGGGGAGGCCTCACGG + Intergenic
957691463 3:83576379-83576401 CTGCTTCTGGTGAGGACTCCAGG + Intergenic
958528968 3:95299707-95299729 CAGCTTCTGGGGAGGAATCAGGG - Intergenic
960150780 3:114246682-114246704 CTGCTTCTGGGGAGGTATCAGGG - Intergenic
960168804 3:114434610-114434632 GTGCTTTTGTAAAGGATTCAAGG + Intronic
962045191 3:131751807-131751829 CTGCTTTTGTAGGGAAAGCAGGG + Intronic
963325173 3:143854649-143854671 GTGATTTTGTTGAGGAACCTGGG - Intergenic
963511713 3:146255897-146255919 CTGCTTCTGGGGAGGACTCAGGG + Intergenic
964445523 3:156753403-156753425 CTGCTTCTGTTGAGGACTTCAGG - Intergenic
965288763 3:166849544-166849566 CTGCTTTATCTGAGGAATCTAGG - Intergenic
965857081 3:173102427-173102449 CTGCTTCTGGTGAGGCCTCAGGG + Intronic
965865300 3:173198441-173198463 CTGCTTCTGGTGAGGCCTCAGGG + Intergenic
966089787 3:176119033-176119055 CTGCTTTTATTTTGGATTCAAGG - Intergenic
966305561 3:178530108-178530130 CTGTGTTTGGTGGGGAATCAGGG + Intronic
966354706 3:179067711-179067733 CTGCTTAGGTGGAGGAAGCACGG + Exonic
969347435 4:6578260-6578282 CTGCTTTTATAGAGTAAGCAAGG + Intronic
969870495 4:10101558-10101580 CTGATTTTGTAGAGGAGCCAAGG - Intronic
970707106 4:18817159-18817181 CTGCTTTTGTTGAGGGCTTCAGG - Intergenic
972258766 4:37386928-37386950 CTGCTTCTGGTGAGGCTTCAGGG - Intronic
972806515 4:42533776-42533798 CTGCTTTGGTGGAGGTAGCAGGG - Intronic
973204688 4:47547149-47547171 CTGCCTTGGTTTAAGAATCATGG + Intronic
973841350 4:54864343-54864365 CTGCTGTTGTTTAGGAATTCAGG - Intergenic
974628295 4:64452216-64452238 CTGCTTCTGATGAGGTTTCAGGG + Intergenic
974900768 4:67994578-67994600 CTGCTTTTCCTCAGGATTCACGG - Intergenic
976585156 4:86789037-86789059 CTGCTTTAGCAGAGGAATGAAGG + Intronic
976839133 4:89410800-89410822 CTGCTAGTGTTGAGGAATGCAGG + Intergenic
977945773 4:102912376-102912398 CTGCTTTTGGTGAAGAAAAAAGG + Intronic
978322567 4:107514636-107514658 CTGCTTTTCTGGAGGTCTCAGGG - Intergenic
978916143 4:114127821-114127843 CTGCTTTGGTGGAGGCAGCAGGG - Intergenic
981673030 4:147309602-147309624 CCTCTTTTGTTGAGACATCACGG - Intergenic
983251507 4:165351441-165351463 CTGCTCTGGTTGAGGTAGCAGGG + Intergenic
983729800 4:170979068-170979090 CTGCTTCTGTGGAGGTAACAGGG + Intergenic
984190559 4:176600881-176600903 CTGCTTTGGTGGAGGTAGCAGGG + Intergenic
985365770 4:189231046-189231068 CTGCTTCTGGTGAGGCCTCAGGG + Intergenic
986214104 5:5702074-5702096 CTGCTTCTGTGGAGGCCTCAAGG + Intergenic
986254027 5:6086867-6086889 TTGCTTGAGTTGTGGAATCATGG - Intergenic
986959091 5:13191681-13191703 CTGCTTCTGTGGAGGCCTCAGGG + Intergenic
988289621 5:29269299-29269321 TTACTTTAGATGAGGAATCAGGG + Intergenic
989577964 5:43006588-43006610 GTGCTTGGGTTGAGGAATCAAGG + Intergenic
990273203 5:54168036-54168058 CTGCTTTTGATAAGGAATATAGG - Intronic
990950355 5:61292689-61292711 GTGTTTTTGTTTTGGAATCATGG + Intergenic
991552718 5:67859306-67859328 CTGCTTTGGTTCATGAATCCAGG + Intergenic
993310132 5:86319349-86319371 CTGCTTCTATTGAGGACTCAGGG - Intergenic
993323180 5:86501073-86501095 CAGCATTAGTTTAGGAATCATGG + Intergenic
993658787 5:90604348-90604370 CTGTTTTTATTGAAGAATCTAGG - Intronic
993837612 5:92834898-92834920 CTGCTGGCTTTGAGGAATCAAGG - Intergenic
994276438 5:97843998-97844020 CTGCTTTAGTTTGTGAATCAGGG - Intergenic
994371738 5:98975495-98975517 CTGCTTCTGGTGAGGCCTCAAGG + Intergenic
994953161 5:106491649-106491671 CTTTTCTTGTTGGGGAATCATGG - Intergenic
998387738 5:141767737-141767759 TAGCTTTTGGTGAGCAATCATGG + Intergenic
999356959 5:150944323-150944345 CTGCTTTGGTTTAGGAAATAAGG - Intergenic
999968076 5:156831357-156831379 CAGCTTTAGTTGAGGAAATATGG + Intergenic
1000186246 5:158860993-158861015 AAGCTTTTGTTGAGGATTTAGGG - Intronic
1000229639 5:159303453-159303475 CTGCTTCTGGTGAGGCCTCAGGG + Intergenic
1001136646 5:169108059-169108081 CTACTTTTGATGAGGAACTATGG - Intronic
1001891260 5:175341095-175341117 CTGCTTCTGGTGAGGCCTCACGG + Intergenic
1003328962 6:5113583-5113605 CAGTTTTTGTTGAAGAATGAAGG + Intronic
1007303113 6:40883411-40883433 CTACTTTAGATGAGGCATCAGGG + Intergenic
1007842002 6:44724038-44724060 CTGCCTTAGTACAGGAATCACGG - Intergenic
1008976838 6:57437052-57437074 CTGCTTCTGGGGAGGCATCAGGG + Intronic
1009164980 6:60329997-60330019 CTGCTTCTGGAGAGGCATCAGGG + Intergenic
1009500228 6:64403815-64403837 CTGCTTATGTAGAGAAATAAAGG + Intronic
1009546810 6:65030648-65030670 CTGCTGTGTTGGAGGAATCAAGG - Intronic
1010544297 6:77130822-77130844 CAACTTTTGTTTAGGATTCAGGG - Intergenic
1010562899 6:77372412-77372434 CTTATTTTATTGATGAATCATGG - Intergenic
1011151465 6:84278330-84278352 CAGTTTTTGTTGTGAAATCATGG + Intergenic
1011471110 6:87708744-87708766 GTGCTTTTCTTGATGATTCATGG - Intergenic
1014781756 6:125573054-125573076 CTGCTGTTGATGGGGCATCAAGG + Intergenic
1015190297 6:130464926-130464948 CTGCTTTTGATGAGGCCTCAGGG + Intergenic
1015371934 6:132463914-132463936 GTGTTTGTGTTGAGGAAGCAGGG - Intronic
1017595605 6:156025619-156025641 CTGCTTCTGGTGAGGCCTCAGGG + Intergenic
1018523592 6:164680768-164680790 CTGCTTTTGTTTTGGACTTACGG - Intergenic
1019053297 6:169201085-169201107 TTTCTTTTGATGAGGAATGAGGG - Intergenic
1019595638 7:1857127-1857149 CTGCTGTTGGTGAGGAGTCCTGG - Intronic
1020570694 7:9857379-9857401 CTGCTTTTTTTCACGAATTAAGG - Intergenic
1021351886 7:19603567-19603589 CTGATATTTTTGAAGAATCAAGG + Intergenic
1022341773 7:29475221-29475243 CTTCTTTTTTTGATGAATAAAGG - Intronic
1022571784 7:31460718-31460740 CTCCTTTTGCTCAGGAATAAAGG + Intergenic
1022658850 7:32347306-32347328 TTGATTTTTTTGAGGAATCAAGG + Intergenic
1023190161 7:37571569-37571591 CTGCTTTTGTTTCTCAATCAAGG + Intergenic
1023920558 7:44626228-44626250 CTGCTTTTGATGTGATATCATGG + Intronic
1026643610 7:72149099-72149121 CTGCTTCTGGAGAGGACTCAGGG - Intronic
1026664998 7:72334576-72334598 CTGCTTCTGTTGAGAAACGATGG - Intronic
1028063254 7:86348319-86348341 CTGCTTTTGGGGAGGCCTCAAGG + Intergenic
1030889500 7:114982016-114982038 CTGCTTTTTCTGTGGAATGAAGG + Intronic
1033791547 7:144797048-144797070 CTGCTGGTGCTGAGGAATCTGGG + Intronic
1038157565 8:25004497-25004519 CTGCTTTTGTTTAGCAATAAGGG + Intergenic
1039575714 8:38622440-38622462 CTGCCCTTGTGCAGGAATCAAGG + Intergenic
1039638552 8:39193861-39193883 CTGCTTCTGTGGAGGAGCCATGG + Intronic
1039710325 8:40049679-40049701 CTGCTTTTGGGGAGGCCTCAGGG - Intergenic
1040003279 8:42597163-42597185 CTGCTTCTGATGAGGCCTCAGGG + Intergenic
1040321126 8:46304083-46304105 ATGCTCTTTTTGAGGAATCTAGG - Intergenic
1041362676 8:57069318-57069340 TTGGTTTTGTTGAGATATCAAGG - Intergenic
1042197260 8:66241697-66241719 CTGCTTCTGGGGAGGACTCAGGG - Intergenic
1043846505 8:85169873-85169895 CTTTTTTTGTTGAGGTATTAGGG + Intergenic
1045016529 8:98005643-98005665 CTGCTTTCTCAGAGGAATCAGGG + Intronic
1045284638 8:100779876-100779898 CTGCTTTTTTTGATGCAGCATGG + Intergenic
1047013885 8:120701963-120701985 CTTGCTTTGTTGAAGAATCAAGG - Intronic
1047962640 8:130022049-130022071 CAGCTTTTCTTGAGGATTTAAGG - Intergenic
1048500599 8:134971217-134971239 CTGCTTCTGGTGAGGCCTCAGGG - Intergenic
1049469475 8:142769013-142769035 CTGGTTTTGTTGAGGCCTCAGGG + Intronic
1050425546 9:5509171-5509193 TTGCTTTTGTAGAAGAAACAAGG + Intergenic
1055172112 9:73271398-73271420 ATGCTTTTGTTGTTGAAACAAGG + Intergenic
1055636869 9:78287588-78287610 CTGCTTTTCATGAGAAAACAAGG + Intergenic
1056109187 9:83377695-83377717 CTGCTTCTGGGGAGGCATCAGGG - Intronic
1057325849 9:94062571-94062593 CTGCTTTTGGGGAGGCCTCATGG + Intronic
1060446935 9:123698148-123698170 GTGATTTTGTAGAAGAATCAGGG - Intronic
1060625858 9:125110677-125110699 CTGCTTCTGTGGAGGCCTCATGG - Intronic
1186086132 X:5992681-5992703 CTGCTTCTGGTGAGGCCTCAGGG + Intronic
1186188344 X:7043450-7043472 CTGCTTCTGGTGAGGCCTCAGGG - Intergenic
1188364636 X:29300058-29300080 CTGCTTTTGTTGAGGAACTCAGG - Intronic
1188672138 X:32893263-32893285 CAGCTTATGTTAAGGAAGCATGG - Intronic
1189186194 X:39057480-39057502 CTGCTTTGGGTGAGAAGTCACGG + Intergenic
1189677452 X:43476429-43476451 CTACTTTTGGGGAGGAATCCAGG + Intergenic
1191979178 X:66907043-66907065 CTATTTTTGTTGAGGCATCTAGG - Intergenic
1192716491 X:73647784-73647806 CTGCTACTGCTGAGGAATCCAGG + Intronic
1196804235 X:119570598-119570620 CTGCTTCTGCTGAGGAATGTGGG + Intergenic
1198093574 X:133355927-133355949 CTGCTTCTGATGAGGCCTCAGGG - Intronic
1199424256 X:147682411-147682433 CTGCTTTGGTGGAGGCAGCAGGG - Intergenic
1199538611 X:148932172-148932194 CTGCTTGTGAGGATGAATCATGG + Intronic
1201181486 Y:11351816-11351838 CTGCTTTTGGTGAAGAAAAAAGG + Intergenic
1201940144 Y:19450298-19450320 CTGCATTTGTTAAGGAACAAGGG - Intergenic