ID: 1093185074

View in Genome Browser
Species Human (GRCh38)
Location 12:16010613-16010635
Sequence GTTTATGAACAGAAGGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 279}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093185074 Original CRISPR GTTTATGAACAGAAGGAGAG AGG Intronic
903644501 1:24886417-24886439 GTTTAGGAACAGCAGAGGAGGGG - Intergenic
904158147 1:28502044-28502066 GTATAGGAAAAGCAGGAGAGAGG - Intergenic
904828789 1:33293614-33293636 GTTGAGGAACAGAAGTGGAGGGG - Intronic
905258069 1:36698235-36698257 GTGTATGTACAGGAGGAGGGGGG - Intergenic
905401419 1:37706402-37706424 GTTGATGAACAGATGGAGGCCGG - Intronic
906234138 1:44193586-44193608 GTTGATGAACAGAAGCAGAAGGG + Intergenic
906287566 1:44597563-44597585 GTGTATGAAAAGAACGTGAGAGG - Intronic
906707530 1:47905623-47905645 GTTTATGTAGAGCAGCAGAGTGG - Intronic
906818809 1:48907426-48907448 GTTTCTCAAAAGCAGGAGAGTGG + Intronic
908066609 1:60413121-60413143 TTTTATAACCAGAAGGGGAGAGG - Intergenic
908314079 1:62915693-62915715 GTTCATGCACACAAAGAGAGAGG - Intergenic
909540374 1:76784843-76784865 GTAGATTACCAGAAGGAGAGGGG + Intergenic
909748288 1:79126498-79126520 GTCTTTGAACAGAAATAGAGAGG - Intergenic
910712382 1:90195355-90195377 GTAGATGAAAAGAGGGAGAGAGG - Intergenic
912341648 1:108921634-108921656 GATTATGAACTGAAGGGCAGGGG - Intronic
916050425 1:161032459-161032481 GCTTTTAAACTGAAGGAGAGGGG - Intronic
916836959 1:168555556-168555578 TTTTATTGACAGAAGGAAAGGGG + Intergenic
917627637 1:176862270-176862292 GTGTTTGGAAAGAAGGAGAGAGG + Exonic
917753683 1:178077899-178077921 GTATAAGAAAAGGAGGAGAGTGG + Intergenic
918446166 1:184618879-184618901 GTTTATGACCTAGAGGAGAGAGG + Intronic
918610212 1:186481512-186481534 ATTTATGGACAGGAGGATAGAGG - Intergenic
919128781 1:193428469-193428491 GTTCATGAAAATAAGGAAAGCGG + Intergenic
919232838 1:194797444-194797466 GTTTATGAAAAGAAGCTGTGTGG - Intergenic
922242567 1:223765498-223765520 GTTTCTGCACAGATGGAGGGTGG + Intronic
923001058 1:230006741-230006763 GTTTTTGAAGAGAGAGAGAGAGG - Intergenic
923045526 1:230352939-230352961 CTTTCTGAAGAGAATGAGAGAGG - Intronic
923218565 1:231872650-231872672 TTTTAAGAACAGATGGAAAGAGG - Intronic
924050305 1:240073778-240073800 GTTAGTGAACAGAAGGAAACAGG + Intronic
1063649818 10:7923196-7923218 GTATGTGAACAGAAATAGAGCGG + Intronic
1063989841 10:11548567-11548589 ATTTATGAAGGGAAGGAGATAGG - Intronic
1064521010 10:16200836-16200858 GTGTGTGAACAGAAGTAGACTGG + Intergenic
1065259182 10:23907212-23907234 GTTGAAGAAAAGAAGGAAAGAGG - Intronic
1065268531 10:24002436-24002458 ATTTTTGTAAAGAAGGAGAGAGG - Intronic
1067150213 10:43726257-43726279 TTTTATAAAGAGGAGGAGAGGGG - Intergenic
1067553559 10:47252471-47252493 GGGGATGAACAGCAGGAGAGAGG + Intergenic
1068706570 10:60083081-60083103 CTCCAAGAACAGAAGGAGAGAGG - Intronic
1069096591 10:64266904-64266926 GTATCGGAATAGAAGGAGAGGGG - Intergenic
1069978815 10:72237860-72237882 ATTTATGCACAGAAGGCTAGTGG - Intergenic
1070504708 10:77103010-77103032 GTGAATGAACCGATGGAGAGGGG + Intronic
1070621282 10:78013525-78013547 GTTTAAGAACAGAAAGAGCCTGG + Intronic
1071310393 10:84337978-84338000 GCTTAGAAACAAAAGGAGAGGGG + Intronic
1071414427 10:85427877-85427899 GTTTCTCAACAGAAGGTGGGAGG - Intergenic
1072082702 10:92047621-92047643 GATTAGGAACAGAAGAAAAGTGG - Intronic
1074385323 10:113012330-113012352 GTTTATGAAACGTAGGAGAGTGG + Intronic
1076153459 10:128184056-128184078 TTTTATGAAAAGAGGGTGAGTGG + Intergenic
1076577918 10:131483263-131483285 GTTTATGAAGGGAGGGATAGAGG + Intergenic
1076825122 10:132963369-132963391 GTTGATGGACAGATGGAGGGAGG - Intergenic
1077572654 11:3353252-3353274 GTGTAGGAATAGATGGAGAGCGG + Intronic
1077799594 11:5524792-5524814 GTTCTTGAACAGAATCAGAGTGG + Intronic
1079427292 11:20355922-20355944 GTCTATTAACAGCAGGAGAATGG - Intergenic
1079556627 11:21766531-21766553 GTTTATCAACAGATTAAGAGAGG - Intergenic
1080089848 11:28334167-28334189 GTATATAAAAAGAGGGAGAGTGG - Intergenic
1080943350 11:36944013-36944035 GTGTGTGAAAGGAAGGAGAGGGG + Intergenic
1081398283 11:42613093-42613115 GTTGATGAACAGAAGCTAAGAGG - Intergenic
1081633581 11:44705652-44705674 GATTATGAACACAAGGACAGAGG + Intergenic
1083574075 11:63776651-63776673 CTTTATGAACAGCATGAGAACGG + Intergenic
1084700097 11:70781063-70781085 GTTTATGAGCCCAAGGAGTGAGG + Intronic
1084841126 11:71849383-71849405 GTTTATGAACAGATGGATAAAGG - Intergenic
1084988984 11:72905250-72905272 CTTTTTGAAAAAAAGGAGAGCGG - Intronic
1087671449 11:101111871-101111893 GTATATAAACAGAAGGGAAGAGG + Intronic
1089607880 11:119652140-119652162 GTTAATGACAAGAAGGACAGGGG - Intronic
1091523150 12:1268522-1268544 CTTTAGGAACAGAGGAAGAGGGG + Intronic
1091798226 12:3309232-3309254 CTTAAGGAACACAAGGAGAGGGG + Intergenic
1091833417 12:3567117-3567139 GTTGATCCACAGATGGAGAGGGG - Intronic
1093185074 12:16010613-16010635 GTTTATGAACAGAAGGAGAGAGG + Intronic
1095758859 12:45804002-45804024 ATATATGAAGAGAGGGAGAGAGG + Intronic
1095830341 12:46578982-46579004 TTTTACAAACAGAATGAGAGAGG - Intergenic
1096938678 12:55315415-55315437 GTTAATGAACTGAAGGAATGAGG + Intergenic
1098752872 12:74317843-74317865 ATATATGAACAAAAGAAGAGAGG - Intergenic
1099306399 12:80961690-80961712 GTTTTTGCACAGAAAGGGAGAGG + Intronic
1099856105 12:88168905-88168927 GTTTATGAGGAGCAGGAGATAGG + Intronic
1100416664 12:94385112-94385134 GGGTATCAACAGAAGTAGAGTGG - Intronic
1103144296 12:118581069-118581091 GTCTATGAGTAGAAGGGGAGTGG + Intergenic
1103289694 12:119835147-119835169 GTTTATCATCAAAAGGAGAAAGG - Intronic
1105633872 13:22198751-22198773 GTTTATTAACAAGAGGAGAACGG + Intergenic
1105781999 13:23714055-23714077 GTTTTTGAATAGATGGAGAAGGG - Intergenic
1105803994 13:23938991-23939013 GTTTTTGAATAGATGGAGAAGGG - Intergenic
1105974312 13:25459796-25459818 GTTCAGGAGCAGCAGGAGAGGGG + Intronic
1106100456 13:26690892-26690914 ATTGATGAACAGATGGAGAGGGG - Intergenic
1106756769 13:32829747-32829769 GTTTTAGAACAGCAGGAGTGGGG + Intergenic
1107147387 13:37073213-37073235 GTTTATGTACAGCAGGAGAATGG + Intergenic
1107199848 13:37701433-37701455 GTTTAAAAAAAGAATGAGAGAGG - Intronic
1107880451 13:44827730-44827752 ATTAATGAAGGGAAGGAGAGAGG - Intergenic
1107884073 13:44859622-44859644 GTTTTTTATCAGAAGGACAGTGG + Intergenic
1108289955 13:48949139-48949161 GTGTATGAACTGAAGGAAAGAGG + Intergenic
1109308375 13:60664161-60664183 GGTTATGAGCAGAGGAAGAGGGG - Intergenic
1110113658 13:71783305-71783327 GTTTATGTTCAGAATGAGAATGG - Intronic
1111223696 13:85241349-85241371 GTTTTTGTGCAGAAGGACAGTGG - Intergenic
1111304423 13:86388479-86388501 GGTTATGAACAAAGGGAGAAAGG + Intergenic
1112768152 13:102768039-102768061 GGATATGAATAAAAGGAGAGAGG + Intronic
1112840833 13:103575845-103575867 GTTTATAAACAGAATGATTGTGG - Intergenic
1115212719 14:30983998-30984020 GTCTAGGAAGGGAAGGAGAGTGG + Intronic
1115490952 14:33957607-33957629 ATATATGAACAGAAGCAGAGAGG - Intronic
1115748148 14:36459446-36459468 GTTAAGGAACAAAAGGAGACTGG - Intergenic
1119589276 14:75870179-75870201 GCTTATGAATAGTAGGAGACTGG - Intronic
1121391861 14:93582680-93582702 GTTTCTGAATAGAAGCAGTGGGG + Intronic
1121744106 14:96274538-96274560 CTTTATGAAATGAAGGAGGGAGG + Intergenic
1121884964 14:97534612-97534634 GTGTAGGAAGAGGAGGAGAGTGG - Intergenic
1122116795 14:99531690-99531712 GTTGGTGAAAAGCAGGAGAGAGG - Intronic
1122716326 14:103698847-103698869 GTGTAGGAACAGGAGGAGGGGGG + Exonic
1123804639 15:23858836-23858858 GTTAATCAACAGATGCAGAGTGG + Intergenic
1124583947 15:30988257-30988279 GGGTAAGAACAGAAGGGGAGAGG + Intronic
1125302145 15:38266702-38266724 ATTTTTAAAGAGAAGGAGAGTGG + Intronic
1125701503 15:41689422-41689444 TTTTAAGGAGAGAAGGAGAGAGG - Intronic
1126484600 15:49166415-49166437 TTTTATGAACAGAAGAATAAGGG + Intronic
1127631997 15:60836271-60836293 CTTTATGTGCAGATGGAGAGAGG + Intronic
1128552969 15:68609991-68610013 TTTTATCAAGAGAAGGAGGGTGG - Intronic
1129584563 15:76849409-76849431 GTTGATGAACAGGAGGTGGGCGG - Intronic
1130003641 15:80070629-80070651 GGTTATGTATAGATGGAGAGTGG + Intronic
1130308868 15:82735377-82735399 GACTAAGAGCAGAAGGAGAGTGG - Intergenic
1131025410 15:89137280-89137302 GTTTGTGAACAGGAAGATAGTGG + Intronic
1131309627 15:91277964-91277986 GTGTAAGAAAAGAAAGAGAGGGG + Intronic
1131360802 15:91788993-91789015 GCTGAAGAACAGCAGGAGAGAGG - Intergenic
1132379237 15:101355023-101355045 ATTTATCAAAAGAACGAGAGAGG - Intronic
1133887682 16:9845812-9845834 TGTGATGAACAGAAAGAGAGTGG - Intronic
1134872782 16:17666877-17666899 GTGTAACAACAGAAGGAGAGGGG - Intergenic
1135592971 16:23717988-23718010 GTGTATGAAGAGAGAGAGAGAGG + Intergenic
1137798960 16:51245124-51245146 CGTGATGAATAGAAGGAGAGTGG - Intergenic
1144169935 17:12649789-12649811 GGGTATGTGCAGAAGGAGAGGGG + Intergenic
1144626630 17:16847282-16847304 GTTCAAGAGCAGAAGGAGAGGGG - Intergenic
1144879802 17:18425429-18425451 GTTCAAGAGCAGAAGGAGAGGGG + Intergenic
1145152432 17:20518955-20518977 GTTCAAGAGCAGAAGGAGAGGGG - Intergenic
1145278959 17:21454757-21454779 GGTGATGAACAGAAGCAGGGAGG - Intergenic
1146163775 17:30573160-30573182 GTTCAAGAGCAGAAGGAGAGGGG - Intergenic
1146497466 17:33336001-33336023 GTTGCTGAACAGAAGGACAGAGG - Intronic
1146826734 17:36029614-36029636 GTGGATGAACAGATGGACAGAGG - Intergenic
1147165589 17:38591520-38591542 CTTTAGTAACAGAAGCAGAGAGG - Intronic
1147580771 17:41625972-41625994 GTTCAAGAGCAGAAGGAGAGGGG - Intergenic
1150114920 17:62538925-62538947 GTTTTTGAAAAGAAGGCAAGTGG + Intronic
1150465408 17:65388490-65388512 CTGTGTGAACAGAAGGATAGTGG - Intergenic
1150979236 17:70122998-70123020 ATTTAAGAGCAGAAGGAGGGAGG - Intronic
1153748386 18:8204144-8204166 GTTTGTGAGCAGAATGAGATTGG + Intronic
1154365927 18:13709097-13709119 GTTTCTGAGCAGAATGTGAGAGG - Intronic
1155051230 18:22149524-22149546 GTTGTGGAACAGAAGGACAGGGG + Intergenic
1156704957 18:39869532-39869554 GTCTATAAAAAGAGGGAGAGAGG + Intergenic
1156712557 18:39964356-39964378 GTATATGTATAGAAAGAGAGAGG + Intergenic
1156777512 18:40810625-40810647 CTTTATGAGCAGAAGTGGAGGGG + Intergenic
1157505394 18:48222643-48222665 GTTTCTGGAAAGAAGGTGAGAGG + Intronic
1157793559 18:50555233-50555255 GTTGAAGAACAGAGGAAGAGTGG - Intergenic
1158086538 18:53657770-53657792 GTTTAAGAAGAGCAGAAGAGGGG - Intergenic
1158089232 18:53691244-53691266 GTATATGGAGAGAATGAGAGGGG - Intergenic
1158961234 18:62589165-62589187 ATTTCTGAACAGAAGTATAGAGG + Intergenic
1159129987 18:64270495-64270517 GTTTGGGAACAGAAGGTGGGAGG - Intergenic
1159901194 18:74047653-74047675 GTTTAGGAAGGGAGGGAGAGAGG - Intergenic
1160108840 18:76005958-76005980 AGTTATGAAGAGAAGAAGAGGGG - Intergenic
1161144291 19:2668411-2668433 GCTTATGAAAAGAATGGGAGGGG + Intronic
1162204741 19:9047301-9047323 GTTTTTCAACGGAAGGAGACAGG - Intergenic
1162557887 19:11398963-11398985 GTTTATGAAGAAAAAGAGACTGG - Intronic
1163883824 19:19949022-19949044 GTGTAGGAATAGGAGGAGAGCGG - Intergenic
1167121657 19:47520985-47521007 GACTATGAACCTAAGGAGAGTGG + Exonic
926143500 2:10382927-10382949 GTTTAAGAACAGGAGGGGAGTGG + Intronic
928368929 2:30724840-30724862 TTTGATGAACAGAATGAGATTGG + Intronic
929627100 2:43420656-43420678 GTTTTTGAGCAGAAGGAATGAGG - Intronic
929746419 2:44664130-44664152 GTTTATTAAAAGCAGCAGAGTGG + Intronic
933044370 2:77517343-77517365 ATTTATAAATAAAAGGAGAGAGG - Intronic
933570065 2:84000106-84000128 GTTTAGGAAGAGAAGGTGGGTGG - Intergenic
933820046 2:86102966-86102988 GTGTATGAATAGATGGATAGAGG - Intronic
934902323 2:98170489-98170511 TTTTTTGAACAAATGGAGAGGGG + Intronic
934960900 2:98671805-98671827 CTTTATGAAAGGAAGGAGGGAGG + Intronic
935307901 2:101755655-101755677 GATGAGGAACAGAGGGAGAGCGG - Intronic
935431627 2:102982139-102982161 GTTGGTGAACTGAAAGAGAGTGG + Intergenic
937715130 2:125023955-125023977 GCATATGAAAAGAAGGAAAGAGG - Intergenic
938457129 2:131473838-131473860 GTTTATGGACAACAGGAAAGGGG - Intronic
938988663 2:136605381-136605403 CTTTATGAAAATGAGGAGAGGGG - Intergenic
939649179 2:144740828-144740850 ATTTATGGCCAGGAGGAGAGAGG + Intergenic
939691330 2:145265271-145265293 GTTTGTGAGAAGAAAGAGAGAGG - Intergenic
940939884 2:159547091-159547113 TTTTATGAACAAAAGTTGAGGGG + Intronic
943663371 2:190583179-190583201 CTTGATGGGCAGAAGGAGAGAGG + Intergenic
945547620 2:211175813-211175835 GTTTGTGAAAAGAAGGCAAGAGG + Intergenic
946511046 2:220356784-220356806 GGGTAGGAAAAGAAGGAGAGTGG + Intergenic
947518182 2:230824850-230824872 GGTTATGAAAAGAATGACAGAGG + Intergenic
948670454 2:239565098-239565120 GTTAATGAACTGGAGAAGAGAGG + Intergenic
1169468346 20:5861146-5861168 GTTGATGAACAAAAGGCCAGTGG - Intronic
1169845498 20:9987438-9987460 GTTTATGCACAGAAGTAGAGAGG + Intronic
1170674911 20:18470039-18470061 GTTTCTGGACAGATGGAGAATGG - Intronic
1171100878 20:22382972-22382994 GTTTATTAAAAGAAAGAAAGAGG - Intergenic
1173281880 20:41635790-41635812 GGTTATGCCCAGAAGGAGTGAGG - Intergenic
1173961462 20:47075571-47075593 GTTTGAGAACAGAAGGGCAGAGG + Intronic
1174102080 20:48135360-48135382 GGTTATGAACAGAAGCAGAATGG + Intergenic
1174309592 20:49641324-49641346 GTTTATGAACAGTTAGAGATTGG - Intronic
1175053549 20:56177301-56177323 GTTCATGAACAGATGAAGTGGGG - Intergenic
1176074713 20:63243213-63243235 GTTTAGGATCAGCAGCAGAGTGG + Intronic
1178749118 21:35283865-35283887 GTGCATGGACAGAGGGAGAGAGG - Intronic
1181384081 22:22530926-22530948 GTTTCTGAACTTAAGGTGAGTGG + Intergenic
1181860421 22:25813683-25813705 CTTTATGAACAGGAAGACAGAGG - Intronic
1182352119 22:29704951-29704973 GTATATTGACAGCAGGAGAGGGG + Intergenic
1183115620 22:35690504-35690526 GTTTATGGCTAGAAGGGGAGAGG + Intergenic
1184344318 22:43903662-43903684 TTTAATGAACAGAAGGAGTCCGG - Intergenic
949643220 3:6063586-6063608 GTTTTTAAACAGAAGGAAATAGG + Intergenic
952193749 3:31050772-31050794 ATTAAAGAACAAAAGGAGAGGGG + Intergenic
952750813 3:36823429-36823451 CGTGATGAACTGAAGGAGAGAGG + Intergenic
953702138 3:45204846-45204868 CTTGATGATCAGAAGGGGAGTGG - Intergenic
954117438 3:48474959-48474981 GTTTATGAACTGAAGTAGAAAGG - Intronic
954289356 3:49641379-49641401 GGTAATGAACAACAGGAGAGAGG - Intronic
954594787 3:51815154-51815176 TTTTGTGCACAGAAGGAGATGGG + Intergenic
955739986 3:62080370-62080392 GTTTAAGAACAGAAGGGGGCTGG - Intronic
956122957 3:65984463-65984485 GTGTTTTAAAAGAAGGAGAGGGG - Intronic
959119024 3:102211114-102211136 TTTTATAAACAGAAGGAAGGTGG + Intronic
960219680 3:115091065-115091087 GTTAAAGAATAGAAGGAGAGTGG + Intronic
960270895 3:115673363-115673385 CTTTATGAACATAAGGAGTAGGG - Intronic
960649048 3:119925785-119925807 GTTTTAGAATAGGAGGAGAGAGG - Intronic
964739954 3:159954716-159954738 ATGTATGAACAGAAGGAGGCAGG + Intergenic
965063342 3:163809712-163809734 GCTCAAGCACAGAAGGAGAGGGG + Intergenic
965251579 3:166350178-166350200 CTTTATGAACAGAATGAAAATGG + Intergenic
966317543 3:178665258-178665280 GTTTATTAACAAGAGAAGAGAGG + Intronic
966509810 3:180749322-180749344 CTTTAAGAGCAGAAGGAGGGTGG + Intronic
967865402 3:194186173-194186195 GGTTATGATCAGAAGTGGAGAGG + Intergenic
967973289 3:195015069-195015091 GTTTATGATAAGAAAGACAGTGG - Intergenic
969663618 4:8544641-8544663 ATTTAAGAATAGAAGGAGTGAGG + Intergenic
969782223 4:9415409-9415431 GTTTATGAACAGATGGATAAAGG - Intergenic
970498664 4:16654235-16654257 GTTTGTGAAAATAAGGAGATTGG + Intronic
974695761 4:65368519-65368541 GTTAATGAAAAGAAAGAGATGGG - Intronic
975867367 4:78737865-78737887 TTTTATGTCCAGAAGAAGAGAGG - Intergenic
977840761 4:101701029-101701051 GGTCATGAACAGCAGGAGATGGG + Intronic
978577238 4:110199248-110199270 ATTAATGAACAGAGGCAGAGTGG + Intergenic
979350608 4:119640530-119640552 GTATTTGAACAGATGGAGAAAGG - Intergenic
979827734 4:125260020-125260042 CTTTAAGAAAAGAAGGAGAATGG - Intergenic
980794456 4:137662885-137662907 GTGAATGAACATAAGGAGATTGG - Intergenic
981504848 4:145488285-145488307 GTTTGGGAAGAGGAGGAGAGAGG + Intronic
982680833 4:158427330-158427352 GAATATGAATAGAAGGAGAATGG - Intronic
982692512 4:158564923-158564945 GTTTAGGAACAGAAGTAGAAAGG - Intronic
983330164 4:166316264-166316286 ATTTAGTGACAGAAGGAGAGAGG - Intergenic
984310756 4:178054757-178054779 GTTTAATAATAGAAGGATAGGGG - Intergenic
985566823 5:623035-623057 GTTTCTGTAGAGAAGGAGCGCGG + Intronic
986075477 5:4332687-4332709 AGTTATGAACAGAAGGAAAATGG + Intergenic
987742100 5:21922980-21923002 ATATATGGAGAGAAGGAGAGAGG + Intronic
988176895 5:27739514-27739536 ATGTATGAACATAAGAAGAGAGG + Intergenic
989648244 5:43659877-43659899 GTTTATCTCCAGATGGAGAGAGG - Intronic
990220339 5:53581473-53581495 GTTTATGTACAGCTGGAGATTGG - Intronic
990468204 5:56088977-56088999 GTTTATGAACAGTAGGGGAAAGG - Intergenic
992742688 5:79790155-79790177 GTTTATGAAGAGAAGATGCGAGG + Intronic
993204533 5:84863058-84863080 GTTTATCAGAAGAATGAGAGTGG + Intergenic
994862586 5:105217290-105217312 GTCTTTGAATAGAATGAGAGTGG - Intergenic
995034081 5:107513699-107513721 GTTTCTGAACAGAAAGAGGCTGG + Intronic
998476529 5:142426969-142426991 GTTTATGAAGAAAACCAGAGGGG - Intergenic
999254194 5:150200736-150200758 GTTTGGGAAAAGAAGGAAAGAGG + Intronic
1000666718 5:164006804-164006826 ATTTATAAACAGAAGGAAAGAGG + Intergenic
1002711385 5:181197285-181197307 GATTATAAACAGAAGATGAGAGG + Intronic
1003705865 6:8528259-8528281 CTATATGCACAGAAAGAGAGTGG + Intergenic
1003870280 6:10397205-10397227 TTCTTTGAACAGAAAGAGAGAGG + Exonic
1004141662 6:13023700-13023722 GTCTATGAGCAGAAAGAGTGCGG + Intronic
1004290688 6:14364150-14364172 ATTTTTGAGCTGAAGGAGAGAGG + Intergenic
1004714444 6:18203882-18203904 GTGTATAAACAGACTGAGAGAGG - Intronic
1005158439 6:22834779-22834801 GTTTATGAACAGAAAGGGCAGGG - Intergenic
1006193318 6:32222573-32222595 CTTTTGGAACAGAAGGAGGGAGG + Exonic
1006325600 6:33351392-33351414 GTTTATTAATATAAGGAGATAGG + Intergenic
1007019663 6:38506704-38506726 GGTCAAGAACAGAAGCAGAGGGG - Intronic
1008802733 6:55389867-55389889 GTTTATGAATAAAAGGAATGTGG + Intronic
1010906369 6:81495307-81495329 TTTTAAGAAAAGAAGGAGATTGG + Intronic
1011575748 6:88796673-88796695 CTCTATGAAGAGAAGGAAAGGGG + Intronic
1011622156 6:89253094-89253116 GTTTCTCAACAGGAGGAGGGTGG - Intergenic
1012240236 6:96862876-96862898 GTTTGTGAAAAGAAGCAGAATGG - Intergenic
1012987400 6:105889258-105889280 GTGGATGAACAGAAGGAAATGGG + Intergenic
1014827060 6:126058575-126058597 GTGTAAGAACTGAAGGAGATAGG + Intergenic
1015522297 6:134143819-134143841 CTTTATGAAAAGAGGAAGAGGGG + Intergenic
1016687126 6:146894635-146894657 TTTGATGAACAGAAAGACAGAGG + Intergenic
1017788601 6:157776042-157776064 GTGGATGAACAGAAGGAAAATGG + Intronic
1019202492 6:170329813-170329835 CTTGATGAAGAGAAGAAGAGTGG - Intronic
1019332230 7:466147-466169 GCTGATGAAAAGCAGGAGAGCGG + Intergenic
1019804747 7:3115368-3115390 GTTTGTGAACAGAAGGGCACAGG - Intergenic
1025115511 7:56254763-56254785 ACTTATGAACAGAAGGAGGACGG - Intergenic
1025733268 7:64125120-64125142 ATTTAGGAACAGAATGGGAGAGG + Intronic
1027418688 7:77998867-77998889 GTTTATGCACAGAAGCAAAGAGG + Intergenic
1030680184 7:112426034-112426056 ATTCATGAAAGGAAGGAGAGAGG - Intronic
1030800969 7:113851396-113851418 GTTTAGGAAGAAAAGCAGAGAGG + Intergenic
1031356103 7:120789041-120789063 GCTGATGAGAAGAAGGAGAGAGG + Intronic
1032044638 7:128594601-128594623 GTTTTTGAAAAGAAGGCAAGCGG + Intergenic
1033766724 7:144501280-144501302 CTTTACCAAAAGAAGGAGAGAGG - Intronic
1033907357 7:146221981-146222003 GTTTGTGAAAGGAAGGAGGGAGG + Intronic
1035351525 7:158250464-158250486 GGTTAAGAGCAGATGGAGAGGGG - Intronic
1035544001 8:465111-465133 GCTTGTGGACAGAAGGAAAGGGG + Intronic
1035659589 8:1336766-1336788 GTTTATTAAAAGAGGGTGAGAGG - Intergenic
1036836907 8:12079034-12079056 GTTTATGAACAGATGGATAAAGG + Intergenic
1036858699 8:12325280-12325302 GTTTATGAACAGATGGATAAAGG + Intergenic
1038050481 8:23805861-23805883 GTTGAGGAGCAGCAGGAGAGGGG - Intergenic
1039541971 8:38380741-38380763 GTTCATGAATAGAAAGAAAGGGG + Intronic
1042225935 8:66514344-66514366 GTTTTTGAACAGATGGGGACAGG - Intronic
1043976033 8:86585866-86585888 GTTTATGGATGGAAGGAGATAGG + Intronic
1044249436 8:89988845-89988867 GATGCTGAACAAAAGGAGAGTGG - Intronic
1044312458 8:90709335-90709357 GAGGATGAACAGAAGCAGAGTGG - Intronic
1044366280 8:91350234-91350256 GTATATGGGAAGAAGGAGAGTGG - Intronic
1045397955 8:101780526-101780548 GTTTAAAAACAGAAGAACAGTGG + Intronic
1045855050 8:106755385-106755407 GTATGTGTACAGGAGGAGAGAGG - Intergenic
1047794351 8:128238988-128239010 GTCTCTGAAAAGAAGGGGAGGGG + Intergenic
1047826096 8:128577423-128577445 TTTTATAAAAAGATGGAGAGAGG + Intergenic
1049264157 8:141658054-141658076 GTTTAGGAAGAGGAGGAAAGTGG - Intergenic
1049322942 8:142006770-142006792 GTATATGTACACACGGAGAGGGG - Intergenic
1050246640 9:3696923-3696945 GTCTATGACCTGAAAGAGAGGGG + Intergenic
1050546216 9:6711446-6711468 CTTTATGATCAAAAGCAGAGTGG - Intergenic
1052048008 9:23817353-23817375 CTTTATGAAGAGAAGGATGGGGG - Intronic
1052551844 9:29961564-29961586 GTTTATGAATATATGGAAAGAGG - Intergenic
1055406209 9:75976340-75976362 GTTTATGTAAAGAGAGAGAGAGG - Intronic
1055935814 9:81603437-81603459 GTTTTTGTATAGAAAGAGAGAGG - Intronic
1057345702 9:94248668-94248690 GATTAGGAGCTGAAGGAGAGGGG - Intergenic
1058180668 9:101794393-101794415 GCTTATGAACACCAGGAGATGGG - Intergenic
1059722653 9:116976187-116976209 GTCTATGGGAAGAAGGAGAGGGG + Exonic
1186084072 X:5967561-5967583 GTTCATGCACAGAAGCAGAAAGG - Intronic
1187685053 X:21807781-21807803 GATTATGAACTGCAGGAGAGGGG + Intergenic
1188627073 X:32298096-32298118 GGTTTTGAACAGAAGCAGAAAGG + Intronic
1192700188 X:73460795-73460817 TTCTTTGAACAGAAGAAGAGCGG - Intergenic
1192944555 X:75951106-75951128 ATTTATGAACAGAAAAAGAAAGG + Intergenic
1193355234 X:80512605-80512627 GCTTGGGTACAGAAGGAGAGGGG - Intergenic
1194574738 X:95597830-95597852 ATTTAGGAACAGAAAGAGATGGG + Intergenic
1195429771 X:104775852-104775874 GTTTATGAAAAAAAAAAGAGAGG + Intronic
1196019953 X:110980922-110980944 GTTTATACACAGAAAGACAGAGG + Intronic
1198438133 X:136636696-136636718 GTTTAGGAACAGAACAAGAGGGG - Intergenic
1199045560 X:143167224-143167246 TTTTATGGACAGAAGGAAACTGG - Intergenic
1202339174 Y:23842740-23842762 TTTTGTGAACATAAAGAGAGTGG + Intergenic
1202531592 Y:25827332-25827354 TTTTGTGAACATAAAGAGAGTGG - Intergenic