ID: 1093186305

View in Genome Browser
Species Human (GRCh38)
Location 12:16023088-16023110
Sequence CAGTTACAGCCCAGGGACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 420
Summary {0: 1, 1: 0, 2: 3, 3: 49, 4: 367}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093186305 Original CRISPR CAGTTACAGCCCAGGGACAC AGG Intronic
900914108 1:5622465-5622487 CATTTACAACCCAGGAACACTGG - Intergenic
901169305 1:7244688-7244710 CAATGAGAGCCCATGGACACAGG + Intronic
901510969 1:9717889-9717911 CAGGTTCAGCCCAGGGATCCGGG + Intronic
902288142 1:15419722-15419744 CAGTTCCAGCTCAGGGAGAAGGG + Intronic
902387331 1:16083395-16083417 CATTTGAAGCCCAGTGACACGGG - Intergenic
904180860 1:28665786-28665808 CAGTTATAGGCCAGGAACAGTGG + Intergenic
904939233 1:34153302-34153324 CAGTTACAGGCCAGGTGCGCTGG - Intronic
904950877 1:34237696-34237718 CAGTGACAGGCCAGGAACAGTGG - Intergenic
906017661 1:42596552-42596574 AATTTACAGTCCAGGGGCACAGG + Intronic
906389075 1:45398194-45398216 CAGTGACAGGCCAGGCACAGTGG - Intronic
907366501 1:53964971-53964993 CAGTTCCAGGCCAGGCACAGTGG - Intronic
908280589 1:62530797-62530819 CAGTTACGGCACAGGGATGCAGG - Intronic
909036074 1:70595310-70595332 CAGTGAGAGCACATGGACACAGG - Intergenic
910775854 1:90873849-90873871 CATTTACTGCAAAGGGACACAGG - Intergenic
910806910 1:91197586-91197608 CAGTCACACCCCAGAGAGACTGG + Intergenic
911310063 1:96281381-96281403 TAGTCACAGACCAGGGACTCGGG - Intergenic
911779909 1:101863259-101863281 CAGCTACTGGCCAGGCACACTGG - Intronic
912478992 1:109963372-109963394 AGTTTACAGCCCAGGGGCACAGG + Intergenic
912491767 1:110066365-110066387 CAGCTACAGCCCAGGGACCAGGG + Intronic
912546075 1:110452784-110452806 CAGTTACAGTCCAGGGAGCAGGG - Intronic
913219016 1:116644575-116644597 CACTTGCAGCCCATGGACACTGG - Intronic
913517428 1:119616391-119616413 CTTTTACAGCCCAGTGTCACTGG - Intergenic
914203545 1:145506797-145506819 AGGTCACAGCCCAGGGGCACAGG - Intergenic
914482667 1:148079951-148079973 AGGTCACAGCCCAGGGGCACAGG - Intergenic
915119163 1:153617731-153617753 CAGTGACAGCCCTGGGAGGCTGG + Intergenic
915728502 1:158036062-158036084 CAGTCAAAACCCAGGGATACTGG + Intronic
916650990 1:166834242-166834264 AGGTCCCAGCCCAGGGACACAGG + Intergenic
916919602 1:169450098-169450120 AAGTCACAGCCCAGGGACACAGG - Intronic
917393273 1:174562801-174562823 CAGTGAGAACACAGGGACACAGG + Intronic
918276704 1:182959770-182959792 CAGCTGCAGCCGAGTGACACTGG + Intergenic
918555103 1:185789880-185789902 CAGTTTCAGCCCAGAGATAGGGG - Intronic
919483166 1:198114069-198114091 CAGTTAGAGCCCAGGTTCAAAGG + Intergenic
919970090 1:202570434-202570456 CAGTTACAGCCTTGGGATAGTGG - Intronic
922638959 1:227207559-227207581 CAGTGAGATCACAGGGACACAGG - Intronic
922795382 1:228337149-228337171 CAGACACACCCCAGGGACCCTGG - Intronic
923351871 1:233115220-233115242 AGGTTACAGCCCGGAGACACAGG + Intronic
923533110 1:234827338-234827360 GAGAATCAGCCCAGGGACACTGG - Intergenic
924401216 1:243684351-243684373 CAGTGAGAACACAGGGACACAGG - Intronic
1063437826 10:6048826-6048848 CAGTTTAAGCCCAGTGACATGGG + Intronic
1063737065 10:8769786-8769808 CAATTGGAGTCCAGGGACACAGG + Intergenic
1063873751 10:10449335-10449357 AAGTTACAGCCCTGTGCCACTGG - Intergenic
1064684541 10:17846193-17846215 CAGTTACAGGCCAGGCACGGTGG - Intronic
1064703878 10:18050254-18050276 AGGTCACAGCCCAAGGACACGGG + Intergenic
1065429042 10:25634870-25634892 CAGTTTAAGGCCAGGGACTCAGG - Intergenic
1065639966 10:27771397-27771419 AAGTCGCAGCCCAGGGGCACAGG - Intergenic
1066113315 10:32216806-32216828 CATTTACTGGCCAGGCACACTGG - Intergenic
1068435195 10:56981989-56982011 CAATTAGAGCACATGGACACAGG - Intergenic
1070553005 10:77505682-77505704 GGGTTGCAGCCCAGGAACACAGG + Intronic
1073160460 10:101389572-101389594 CAGTTACAGTCAAGTTACACTGG + Intronic
1073248532 10:102107902-102107924 CAGGCCCAGCCCAGGGCCACTGG + Exonic
1073318481 10:102599554-102599576 TTGTTCCAGCCCAGGGACACTGG - Intronic
1075710314 10:124527176-124527198 CGCTTACAGCCCAGGGGCAGGGG + Intronic
1076469179 10:130706748-130706770 CAGGTAAGGCCCCGGGACACTGG + Intergenic
1076600735 10:131655356-131655378 CAGAAACAGCCCCGGGACCCTGG - Intergenic
1077197595 11:1289065-1289087 CAGTTCCACTTCAGGGACACTGG + Intronic
1080122116 11:28690184-28690206 CAGTAAATGCCCAGGTACACAGG - Intergenic
1081545331 11:44067474-44067496 TGGTTACAGCTAAGGGACACAGG + Intronic
1081578272 11:44333323-44333345 CAGTGAGAGCACATGGACACGGG - Intergenic
1081775661 11:45674523-45674545 CAGTTTCACCCCAGGGAATCTGG - Intergenic
1083381347 11:62271235-62271257 GAGTGACAACACAGGGACACTGG - Intronic
1083658217 11:64240507-64240529 GAGTCACAGCCCAGGTGCACAGG + Intergenic
1084274837 11:68045980-68046002 CAGATCCAGCCCCAGGACACTGG - Intronic
1084729224 11:71062512-71062534 CAGTTACAGCCCAGAGCAAATGG - Intronic
1084889215 11:72228529-72228551 CAGGTAGAGCCAAGGGACAGGGG - Intronic
1085282004 11:75337161-75337183 CAGTTTCAGACCAGGCACAGTGG + Intronic
1085444789 11:76593125-76593147 CAGGTACAGCCCAGGTCCACAGG + Intergenic
1088808847 11:113375838-113375860 CAGTGACAGCCCAGGCATAGCGG - Intronic
1089488922 11:118869488-118869510 CAGTTACAAGCCAGGCACAGTGG + Intergenic
1090014558 11:123074548-123074570 AAGTTCCAGCCTAGGGACAGAGG - Intronic
1090306264 11:125693720-125693742 CTGTCTCAGCCCAGGGCCACAGG - Intergenic
1090439860 11:126716505-126716527 CAGCCACATCCCAGGGAAACAGG + Intronic
1090578994 11:128139464-128139486 AGGTTACAGCCCAGGGGTACAGG + Intergenic
1090609262 11:128455692-128455714 CTGTTACTGCCCAGGGCCAGTGG + Intergenic
1091926770 12:4357719-4357741 AAGTGACAGGGCAGGGACACTGG + Intergenic
1092315598 12:7410316-7410338 CAGTTAAAGGCCAGGCACAGTGG + Intronic
1093096014 12:14973190-14973212 CAGCCACAGCCCAGGCCCACAGG - Intronic
1093186305 12:16023088-16023110 CAGTTACAGCCCAGGGACACAGG + Intronic
1094361213 12:29633262-29633284 CAGTCATAGCACAGGGTCACGGG + Exonic
1095780763 12:46056610-46056632 CAGTGAGAGCACATGGACACAGG + Intergenic
1096478906 12:51924933-51924955 CAGTCCCAGCCCTGGGAGACTGG - Intergenic
1098301049 12:69054516-69054538 GAGTTGCAGCCCAGAAACACAGG + Intergenic
1098838663 12:75452674-75452696 ACTTTACAGTCCAGGGACACTGG - Intergenic
1101970504 12:109309321-109309343 CAGTTACAGGGCAGGGTCAAGGG + Intergenic
1103612949 12:122135179-122135201 CAGGTGCAGCCCTGGGCCACAGG - Intronic
1103942122 12:124506839-124506861 CCGTCACAGCCCAGGGGCACGGG - Intronic
1104327550 12:127813458-127813480 ATGTTACAGCCTGGGGACACGGG + Intergenic
1107980132 13:45727371-45727393 AGGTCACAGCCCAGGGGCACAGG - Intergenic
1109186521 13:59275546-59275568 AAGTGACAGCCCAGGGGCACAGG + Intergenic
1109569809 13:64172925-64172947 TAGTTACATCTCAGGGACACAGG + Intergenic
1110790808 13:79584714-79584736 AGGTCACAGCCCAGGGACACAGG + Intergenic
1110867758 13:80416758-80416780 AGTTTACAGCCCAGGGAGACAGG - Intergenic
1111813728 13:93123934-93123956 CAGGTACAGGCCAGGCACAGTGG - Intergenic
1111818134 13:93180761-93180783 AGCTCACAGCCCAGGGACACAGG - Intergenic
1112278667 13:98044043-98044065 AAGTTACAGCCCAGGAGCAGGGG + Intergenic
1112588095 13:100737535-100737557 CACTTACAGAGCAGGCACACTGG - Intergenic
1113049452 13:106193314-106193336 CAGTAAGAACACAGGGACACAGG + Intergenic
1113086717 13:106576509-106576531 AGGTCACAGCCCAGGGTCACAGG - Intergenic
1113444470 13:110355171-110355193 CAGTTACACCTAAGGGACCCTGG - Intronic
1113905171 13:113815993-113816015 CAGTCACTGCTCAGGGACACGGG + Exonic
1113905182 13:113816069-113816091 CAGTCACTGCTCAGGGACACGGG + Exonic
1115100250 14:29689915-29689937 CAGTGACAACACATGGACACAGG + Intronic
1116433285 14:44870559-44870581 CAGTGAAAGCACATGGACACAGG - Intergenic
1116915217 14:50518437-50518459 CAGTGAGAACACAGGGACACAGG - Intronic
1117855186 14:60023840-60023862 CAGTGAGAGCACATGGACACAGG - Intronic
1118561992 14:67095726-67095748 CAGTGAGAACCCATGGACACAGG + Intronic
1118977629 14:70691409-70691431 AAGTTACAGGCCAGGTACAGTGG - Intergenic
1119069091 14:71563014-71563036 GAGTTACAGTCCAGGGAAACAGG - Intronic
1119103154 14:71898711-71898733 CAATGAGAACCCAGGGACACAGG - Intergenic
1119730561 14:76948392-76948414 CAGCTACAGCACAGGCACTCCGG + Intergenic
1121729972 14:96179842-96179864 CAGATATAGCCCAATGACACTGG + Intergenic
1121757268 14:96413518-96413540 CGATTAGAGCCCAGGGACAGGGG - Intronic
1122211345 14:100175939-100175961 CCGGTGCAGCCCATGGACACAGG + Intergenic
1122551617 14:102553072-102553094 TTGTTCCAGACCAGGGACACAGG + Intergenic
1122715866 14:103696818-103696840 CAGTTCCAGGCCAGGGCCATGGG - Intergenic
1123576085 15:21670677-21670699 CAGTGAGAACACAGGGACACAGG - Intergenic
1123612706 15:22113151-22113173 CAGTGAGAACACAGGGACACAGG - Intergenic
1124122247 15:26897829-26897851 CAGTTGCATCCCCGAGACACAGG - Intronic
1124171819 15:27381103-27381125 AGGTCACAGCCCAGGAACACAGG - Intronic
1124346810 15:28928529-28928551 CAGTCACAGCCCAGGGAAATGGG - Intronic
1124599044 15:31116276-31116298 AAGTCACAGCCCAAGAACACAGG + Intronic
1125711993 15:41794621-41794643 CAGTGAAAGCCCAGGAAAACTGG - Intronic
1126470180 15:49001656-49001678 CAGTTAGAACACATGGACACAGG - Intronic
1129031673 15:72622990-72623012 CAGTTTCAGGCCAGGCACAGTGG - Intergenic
1129409132 15:75339170-75339192 CAGGTACACCTCAGGGTCACAGG - Intronic
1130675092 15:85945157-85945179 TATTTACAGCCCAGGCACAGTGG - Intergenic
1130691609 15:86086197-86086219 CAGTTCCAGCCCTGGGAGATGGG + Intergenic
1131409142 15:92191467-92191489 CATTCACAGCCCAGGGACTTTGG + Intergenic
1202984953 15_KI270727v1_random:404922-404944 CAGTGAGAACACAGGGACACAGG - Intergenic
1133124525 16:3637429-3637451 AAGTCACAGGCCAGGGGCACAGG - Intronic
1133130055 16:3671434-3671456 CAGTCACAACCCTGGGGCACAGG + Intronic
1135601082 16:23784010-23784032 CAGTGAGATCACAGGGACACAGG - Intergenic
1136556000 16:31008257-31008279 TAGTCACAGCTCAGGGAAACTGG - Intronic
1137308910 16:47233744-47233766 AGGTCACAGCCCAGGGACACAGG + Intronic
1138599336 16:58045784-58045806 CAGTTACAGCCCTGGGGTTCAGG - Exonic
1138890041 16:61130735-61130757 CATTCACAATCCAGGGACACTGG - Intergenic
1139128570 16:64112734-64112756 CTGTCACGGCCCAGGGAAACAGG - Intergenic
1140181965 16:72729189-72729211 CAGCTGCAGCCAAGTGACACTGG - Intergenic
1140370432 16:74410267-74410289 GAGTCACAGCCAGGGGACACTGG + Intronic
1140410536 16:74738165-74738187 CCGTCTCAGCCCAGAGACACAGG + Intronic
1141032651 16:80603014-80603036 CCCTTGCAGCCCAGGGGCACAGG + Exonic
1141560722 16:84866159-84866181 CAGTGAAAACCCAGGGACAGGGG + Intronic
1142187590 16:88701788-88701810 CAGGGACAGCCCGGGGACTCTGG + Intronic
1142720120 17:1770346-1770368 CAGTTACATCCCAGGAACCTAGG - Intronic
1142918005 17:3159317-3159339 CAGTGAGAACACAGGGACACAGG + Intergenic
1142990887 17:3730084-3730106 CAGTGAGAGCACATGGACACAGG - Intronic
1142991026 17:3730995-3731017 CCCTTACAGCCCAGGGAGAAAGG - Intronic
1143789963 17:9286965-9286987 CATTTACAGCCCCGTGAGACAGG - Intronic
1144131775 17:12253446-12253468 CATTTACATCCCCGGCACACTGG + Intergenic
1144201591 17:12947201-12947223 CAGTTTTAGCCCAGTGACAGGGG - Intronic
1145961081 17:28886858-28886880 CAGTGCCAGCCCTGGGGCACTGG + Intronic
1146588882 17:34110515-34110537 CAGCTACAGCCCAGGGCAGCAGG - Intronic
1148139887 17:45320791-45320813 CTGTTACAGCAAAGTGACACTGG - Intergenic
1148243630 17:46016035-46016057 CAGCTACAGCACAGGAACCCTGG + Intronic
1149191417 17:54067664-54067686 CAATTACAACACATGGACACAGG - Intergenic
1150512006 17:65764011-65764033 CATTTACAGCCCAGAGGCACAGG - Intronic
1150858991 17:68781311-68781333 CAGAAACAGACCAGGGAAACAGG - Intergenic
1151566935 17:74903874-74903896 CAGGAACAGACCAGGAACACAGG - Intergenic
1156114838 18:33775353-33775375 AAGTTATAGTCCAGGGACTCAGG - Intergenic
1157622921 18:49026562-49026584 CAGTGACAGCCCAGGCACACAGG + Intergenic
1158881356 18:61782383-61782405 CATTTTCTTCCCAGGGACACTGG - Intergenic
1158987419 18:62832524-62832546 CAGTAACAGACCTGGGAAACAGG - Intronic
1159217500 18:65413987-65414009 CAGTTACTTCCCAGACACACTGG + Intergenic
1159749238 18:72280038-72280060 CAATGACAGCACATGGACACAGG + Intergenic
1159865738 18:73702743-73702765 CTGTAACAGCCCAGAGACACTGG - Intergenic
1160782791 19:885226-885248 CAGGGACAGCAAAGGGACACAGG + Intronic
1160957227 19:1699343-1699365 CCGAGACAGCCCAGGGTCACAGG - Intergenic
1163474876 19:17519873-17519895 CAGTTACAGACCAGGCACAGTGG + Intronic
1163624879 19:18383341-18383363 CAGTTACAGCCCCACGGCACTGG - Intronic
1165607881 19:37122410-37122432 CAGTGAGAACACAGGGACACAGG + Intronic
1166168081 19:41006504-41006526 CAGTTAAATCCCAGGGATAGGGG - Intronic
925158966 2:1669247-1669269 CAGTGAGAACCCATGGACACAGG + Intronic
925183592 2:1832317-1832339 GACTTCCAGCCCAGGGACAGGGG + Intronic
925302820 2:2829058-2829080 CAGGTTCATCCCAGGGACTCTGG - Intergenic
926793939 2:16603418-16603440 CAGTGACAGATCAGGGTCACTGG + Intronic
926866892 2:17370068-17370090 CAGTGACAACACATGGACACAGG - Intergenic
927026007 2:19070031-19070053 CAGTTAGAGGCCAGGCACAGTGG + Intergenic
927206827 2:20616380-20616402 CAGCTTCAGCCCTGGGACCCAGG - Intronic
927696439 2:25242634-25242656 CAGTCTCAACCCAGGGACCCTGG - Intronic
928259364 2:29752962-29752984 CAGACCCAGCCCAGGGTCACAGG + Intronic
928629463 2:33175952-33175974 CAGTGAGAACCCATGGACACAGG + Intronic
928949763 2:36804317-36804339 CAGTTCCAGGCCAAGGGCACAGG - Intronic
929832606 2:45359024-45359046 CAGGTACAGGCCAGGGAGGCAGG - Intergenic
930801945 2:55451968-55451990 CACTTCCAGGCCAGGGACTCAGG + Intergenic
931865142 2:66401411-66401433 AGGTTACAGCCCAGAGGCACAGG + Intergenic
932427927 2:71654789-71654811 AAGTTACAGGCCAGGCACAGTGG + Intronic
932743144 2:74307418-74307440 CAGCTACAGCCGAGTGACACTGG + Intronic
933245129 2:79966521-79966543 CAGTTACAGGCCAGGCACAGAGG - Intronic
933557816 2:83852053-83852075 CAGTGAGAACACAGGGACACAGG + Intergenic
934765015 2:96875760-96875782 CAGTTACAGCACTGGGGCCCAGG - Intergenic
935248221 2:101237677-101237699 CTGTTTCAGGCCAGGCACACTGG + Intronic
937329421 2:121016607-121016629 CACTTTCAGGCCAGGAACACTGG + Intergenic
937721942 2:125109320-125109342 AAGTCACAGCCCAGAGACAGAGG - Intergenic
940012212 2:149066370-149066392 CAGTGACAACACATGGACACAGG - Intronic
940120687 2:150261337-150261359 AAGTCAGAGCCCAGAGACACAGG + Intergenic
942076342 2:172360003-172360025 CAGGTAAAGCCCAGGGGCATTGG - Intergenic
942108411 2:172656401-172656423 AGGTCACAGCCCAGGGACACGGG - Intergenic
942605805 2:177689367-177689389 GAGTTACAGGCCGGGGACAGTGG - Intronic
942932464 2:181512288-181512310 CAGTGACAGGGCAGGGAAACGGG + Intronic
943136875 2:183924794-183924816 CAATGAGAGCCCATGGACACAGG + Intergenic
943380208 2:187135346-187135368 CAATGACAGCACATGGACACAGG - Intergenic
944476335 2:200110483-200110505 CAGTCCCAGCCCAGAGACAAGGG - Intergenic
945780213 2:214161622-214161644 CAGTGAGAGCACATGGACACAGG + Intronic
948506082 2:238427577-238427599 CAGGCACAGACCAGGGACAACGG + Intronic
948989909 2:241548471-241548493 GGGTTACAGCTGAGGGACACGGG + Intergenic
949031522 2:241799468-241799490 CAGATCCAGCCCAGGCCCACAGG - Intronic
949051238 2:241898697-241898719 CAGGCACAGCCCAGGGACCCAGG - Intronic
1169421819 20:5466541-5466563 CAGGTAAAGCCCAGGGATCCTGG - Intergenic
1169457057 20:5761203-5761225 CAGTGAGAACACAGGGACACAGG + Intronic
1170163755 20:13342469-13342491 CTGTGACAGCCTCGGGACACAGG + Intergenic
1172016800 20:31880346-31880368 CAGTGCCGGCCAAGGGACACAGG + Intronic
1172089674 20:32421015-32421037 CAGTGAGAACCCATGGACACAGG + Intronic
1172106770 20:32521805-32521827 CAGTCTCAGCCCAGGGAACCTGG - Intronic
1172595712 20:36149720-36149742 CAGTGACAGCCCCAGGCCACTGG - Intronic
1173261806 20:41443066-41443088 CAGTTACAGCTGAGGGGCAGAGG - Intronic
1173680291 20:44874596-44874618 AGGTTATAGCCCAGGGACTCGGG + Intergenic
1175522115 20:59608661-59608683 CAGCGACAGCCAAGGGACAGGGG - Intronic
1175686937 20:61038092-61038114 CTGTCACAGCCCTGAGACACAGG - Intergenic
1175731747 20:61358883-61358905 CAGTTTCAGCCCAGGGTGACGGG + Intronic
1176097787 20:63352255-63352277 CAGGTCCAGCCCTGGGACTCGGG - Intronic
1179156352 21:38854256-38854278 AGGTCACAGCCCAGGGACACAGG + Intergenic
1179496575 21:41775605-41775627 CAGTTACAGCCAATGGGCAGTGG + Intergenic
1179791383 21:43757757-43757779 CCGTTGCAGCCCAGAGCCACTGG + Exonic
1180820307 22:18822631-18822653 CACTTGCAGCCCATGGACATTGG - Intergenic
1180887581 22:19258096-19258118 CATCTACAGCCCAGTGACACTGG - Intronic
1181092481 22:20483510-20483532 CAGCTACAGCTGAGGGACATTGG + Intronic
1181206532 22:21257103-21257125 CACTTGCAGCCCATGGACACTGG - Intergenic
1181285433 22:21748538-21748560 AGGTCACAGCCCAGGGACACAGG + Intergenic
1181303076 22:21895718-21895740 CAGTCACAGGCCAGGCACAGTGG + Intergenic
1181974619 22:26720155-26720177 CAGTCCCAGCCCAGGGACTCTGG + Intergenic
1183149046 22:36022982-36023004 CTGTGGCAGCCCAAGGACACTGG + Intronic
1183432146 22:37772410-37772432 CTGGTACCACCCAGGGACACAGG - Intronic
1183585456 22:38750711-38750733 CAGTCACAGCCCAGGGCACCAGG + Intronic
1203220388 22_KI270731v1_random:38320-38342 CACTTGCAGCCCATGGACACTGG + Intergenic
1203270437 22_KI270734v1_random:48506-48528 CACTTGCAGCCCATGGACACTGG - Intergenic
950672161 3:14533748-14533770 CAGTGACAGCTTAGGGACAGCGG + Intronic
950896722 3:16458907-16458929 AAGTTACAACCCAGGGCTACTGG + Intronic
951699698 3:25483112-25483134 GAATTACAGCCAAGCGACACAGG + Intronic
952068042 3:29595924-29595946 CAGTTAGATCCCAAGGACAAGGG + Intronic
952336645 3:32409166-32409188 AAGTTACGGCCCAGGCACAGTGG - Intronic
952493428 3:33894299-33894321 CAGTTTCACCCCAGGGATGCAGG - Intergenic
952842060 3:37654886-37654908 CAATGACAACACAGGGACACAGG - Intronic
953884442 3:46707503-46707525 CAATAACAGCCCAGGCAGACTGG - Intronic
953912072 3:46898333-46898355 CAGTCAGAGCCCTGGGACCCAGG - Intronic
953980309 3:47410202-47410224 CTGATACAGCCCAGGGCCCCAGG + Exonic
955147004 3:56329655-56329677 AGGTCACAGCCCAGGGGCACAGG + Intronic
956390418 3:68766742-68766764 CAGTTAGTGCCCAGAAACACGGG + Intronic
956557675 3:70540638-70540660 CAGGTACATCCCAGGGATTCTGG + Intergenic
957376960 3:79370880-79370902 CAGTGACAACACATGGACACAGG - Intronic
958980874 3:100718212-100718234 CAGTTAAAGGCCAGGCACACTGG - Intronic
960036190 3:113105174-113105196 CAGCTTCAGCCCAGGGGCTCTGG - Intergenic
960749897 3:120936963-120936985 AGGTCACAGCCCAAGGACACAGG - Intronic
961360753 3:126365722-126365744 CAGTCACAGCTCAGGGAAACTGG - Intergenic
962494603 3:135926650-135926672 CATTTACAGGCCAGGGACTAAGG + Intergenic
963478326 3:145834801-145834823 CAGTGACAACACATGGACACAGG + Intergenic
964013701 3:151921236-151921258 AAGTCACAGCCCACAGACACAGG - Intergenic
964761469 3:160138408-160138430 CAATGACAGCACATGGACACAGG + Intergenic
965036352 3:163443556-163443578 AGGTTACAGCCCAGGGGTACAGG + Intergenic
965560370 3:170056462-170056484 CAATAACAGCCCGGGGAAACAGG + Intronic
965803837 3:172521991-172522013 CAGTGAGAGCACATGGACACAGG + Intronic
966259615 3:177960268-177960290 CAGTTACAGAACAGGGCCAAGGG - Intergenic
968046408 3:195626113-195626135 CGGTGACAGCCCCGGGTCACAGG + Intergenic
968308245 3:197663978-197664000 CGGTGACAGCCCCGGGTCACAGG - Intergenic
968522414 4:1039963-1039985 TTGTCACAGCCTAGGGACACTGG + Intergenic
968600887 4:1508845-1508867 CTGCCACAGCCCAGGGAAACAGG - Intergenic
968849951 4:3072464-3072486 CAGGTACAGCCCAAGCTCACGGG + Intergenic
969264998 4:6058607-6058629 CAGTTCCAGCCAATGGAGACAGG + Intronic
969376070 4:6764017-6764039 CAGAAACAGGCCAGGCACACTGG + Intergenic
969631556 4:8341651-8341673 CAGTCACTTCCCAGGCACACAGG - Intergenic
970026384 4:11628582-11628604 CAGTTGCAGACCAGGGCCCCAGG + Intergenic
970519962 4:16872967-16872989 CATTGACAGCCCAGTGACAGGGG + Intronic
970669755 4:18382654-18382676 CTGTTACATCCCAGGGATACTGG + Intergenic
971181469 4:24331978-24332000 CAGTGACAACACATGGACACAGG - Intergenic
971285418 4:25284687-25284709 CAGTGAGAACACAGGGACACAGG - Intergenic
971477808 4:27088820-27088842 AGCTCACAGCCCAGGGACACGGG - Intergenic
971740739 4:30517356-30517378 CAGTGAGAACACAGGGACACAGG + Intergenic
972219836 4:36941534-36941556 CAATGACAGCACATGGACACAGG + Intergenic
972269384 4:37495656-37495678 CAGTTAGAACACACGGACACAGG + Intronic
973130454 4:46641871-46641893 AAGATACAGCCCAGGCACAGTGG + Intergenic
973839650 4:54848139-54848161 CAGTGACTGCACAGGGAGACTGG - Intergenic
974039357 4:56844601-56844623 CAGTCACAGACCAGGGACAACGG + Intergenic
974963091 4:68728006-68728028 GAGTTTCATCCCAGGGATACAGG - Intergenic
975309776 4:72890604-72890626 CAGTGAGAGCACATGGACACAGG - Intergenic
975512392 4:75208310-75208332 AGGTTCCAGCCCAGGGACACAGG - Intergenic
976043066 4:80911161-80911183 AAGGAACAGCCCAGGGACATAGG - Intronic
976064471 4:81168496-81168518 CAAATACAACCCAGGCACACTGG + Intronic
976653008 4:87456283-87456305 GGGTCACAGCCCAGGGCCACAGG - Intronic
976947118 4:90783812-90783834 AAGACACAGCCCAGGGATACAGG + Intronic
977616404 4:99091449-99091471 AGTTTACAGCCTAGGGACACAGG + Intergenic
978218537 4:106239288-106239310 AGGTCACAGCCCAGGAACACAGG + Intronic
978522890 4:109634996-109635018 CAGTGAGAGCACATGGACACAGG - Intronic
978663588 4:111155534-111155556 ATGTCACAACCCAGGGACACAGG - Intergenic
979023791 4:115540770-115540792 AGGTTACAACCCAGGGAAACTGG - Intergenic
979971591 4:127142396-127142418 ATGTCACAGCCCAGGTACACTGG + Intergenic
980338089 4:131501330-131501352 AGGTCACAGGCCAGGGACACAGG + Intergenic
980509111 4:133761312-133761334 AAGTCACAGCCCAGGGATGCAGG - Intergenic
981521150 4:145663703-145663725 AAGTCACAGCCCAGAAACACAGG + Intergenic
984137710 4:175961878-175961900 AAGTTACAGCCCAAGGGCACAGG + Intronic
986670527 5:10139357-10139379 CACTAGCAGCCCAGGGACTCGGG - Intergenic
988072960 5:26318021-26318043 GAGTTTCATCCCAGGGATACAGG - Intergenic
989012216 5:36885777-36885799 TAGCTACAGCCAAGTGACACTGG - Intronic
991679952 5:69129093-69129115 TAGTTACAGGCCAGGCACAGTGG - Intronic
992492354 5:77257865-77257887 CAGTGAGAGCACATGGACACAGG - Intronic
992669768 5:79047598-79047620 CAGGTACAGCTCAGGGACGCGGG - Intronic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
994388163 5:99157619-99157641 CAGTGAGAACACAGGGACACAGG - Intergenic
994770180 5:103971978-103972000 CATTCACAGCCCAGAGGCACAGG + Intergenic
995321304 5:110837360-110837382 AGGTCACAGCCCAGGGACACAGG - Intergenic
996538631 5:124605749-124605771 CAGTGACAGCACACTGACACAGG + Intergenic
998173763 5:139887588-139887610 CAGTTCCAGCCCAAAGACAGTGG - Intronic
998961448 5:147491233-147491255 CATTCACAGTCCAGGGTCACAGG + Intronic
1000341968 5:160284800-160284822 TAGATAAAGCCCAGGGACTCAGG - Intronic
1003250112 6:4420379-4420401 GGGTCACAGCCCAGGGGCACAGG + Intergenic
1003979820 6:11379105-11379127 CAATTCCAGCCCAGTGGCACAGG + Intronic
1004352389 6:14901760-14901782 CAATCAGAGCACAGGGACACAGG + Intergenic
1005871214 6:29975445-29975467 CAGGAACAGCCCAGGAACCCAGG + Intergenic
1006050322 6:31337151-31337173 CAGTTCCAGCCAATGGAGACAGG - Intronic
1006410818 6:33872335-33872357 CAGTAGCAGGCCAGGGACAGTGG + Intergenic
1009627839 6:66160028-66160050 AGGTCACAGCCCAGGGATACAGG + Intergenic
1010835523 6:80583115-80583137 CAATTACAGGCCAGGCACAGTGG + Intergenic
1010934287 6:81842475-81842497 TGGAGACAGCCCAGGGACACAGG + Intergenic
1011693972 6:89895476-89895498 CACTGCCAGCCCAGGGACACGGG - Exonic
1011830749 6:91368403-91368425 CAGTGAGAACACAGGGACACAGG - Intergenic
1012452549 6:99368563-99368585 TAGTTATAGCACATGGACACAGG + Intergenic
1012680086 6:102169259-102169281 CAGTGAAAACACAGGGACACAGG + Intergenic
1013572375 6:111441945-111441967 CGGTCACACCCCCGGGACACAGG - Intronic
1014203343 6:118627996-118628018 AAGTTACAACCCAGGGGCACCGG + Intronic
1015757402 6:136621611-136621633 AATTCACAGCCCAGGGGCACTGG - Intronic
1016506833 6:144791417-144791439 CATTTACAGACCAGGCACAGTGG + Intronic
1017664223 6:156703700-156703722 CAGTGTCTGCCCAGGGACACAGG - Intergenic
1017758686 6:157551388-157551410 CAGTGACAGGCCTGGGACCCTGG + Intronic
1017956944 6:159186601-159186623 CAGGCAGAGCCCAGAGACACAGG + Intronic
1018273175 6:162102232-162102254 CAGTGAGAACACAGGGACACAGG - Intronic
1018832586 6:167455743-167455765 CAGTTAGAGGCCATGGTCACTGG - Intergenic
1019122255 6:169812498-169812520 CAGCTACAGCCCACGGAGCCAGG + Intergenic
1019135870 6:169907484-169907506 CAGCTGCAGGCCAGGGGCACAGG + Intergenic
1019665359 7:2249537-2249559 CAGTGACAGCCCAGGCCCAGTGG - Intronic
1019837043 7:3398376-3398398 AGGTCACAGCCCAGGGACTCAGG - Intronic
1020011760 7:4809181-4809203 CAGTGACAGCCCGGGGAGGCGGG - Intronic
1020129114 7:5549482-5549504 CAGTTACAGCCCAGAGACCCAGG - Intronic
1020853800 7:13391529-13391551 CAGTGAGAGCACACGGACACAGG + Intergenic
1020963951 7:14842757-14842779 CATTTAAAGCCCTGGGAGACAGG - Intronic
1022440724 7:30430787-30430809 CTGTTACTGCCCAAGCACACAGG + Intronic
1023589850 7:41770289-41770311 CAGTGAGAGCACATGGACACAGG + Intergenic
1023705603 7:42938617-42938639 AAGTTAAAGGCCAGGCACACTGG - Intronic
1023876714 7:44290122-44290144 CAGTGACAGCCAAGGGCCATGGG + Intronic
1024057311 7:45670209-45670231 CAGGAACAGCCCAAGGCCACAGG - Intronic
1024388029 7:48775533-48775555 TAGTCAAAGCCCAGGGACAGTGG - Intergenic
1024984456 7:55183097-55183119 CAGCCACAGCCCAGGGATGCTGG - Intronic
1025972728 7:66343026-66343048 AAGTCACGGCCCAGGCACACAGG + Intronic
1026268033 7:68812493-68812515 CACTGACAGCCCAGTGACATTGG + Intergenic
1027684952 7:81268061-81268083 AAGTTACATCACATGGACACAGG - Intergenic
1028220784 7:88194462-88194484 CAGAGACAGCCCAGAGACAGGGG - Intronic
1028865889 7:95710972-95710994 GGGTTATAGCCCAGAGACACAGG + Intergenic
1029194364 7:98794468-98794490 CAGTGAGAACCCATGGACACAGG - Intergenic
1029266870 7:99349348-99349370 AACTTACAGGCCAGGCACACTGG - Intronic
1030395740 7:108984065-108984087 CAGTTAAAGGCCAGGCACAGTGG - Intergenic
1032567474 7:132961449-132961471 CAGTTACACCCCAGTAAAACTGG - Intronic
1036708464 8:11061932-11061954 CAGGGCCAGCCGAGGGACACAGG - Intronic
1037048794 8:14342933-14342955 CACACACAGCCCAGGGACCCTGG - Intronic
1039347392 8:36722661-36722683 AAGTTACAGCTCAGGGACATAGG - Intergenic
1039501395 8:38020477-38020499 CATTTACAGGCCAGGCACAGTGG - Intergenic
1043957239 8:86374981-86375003 GAGTTACAGGCCAGGCACAGTGG - Intronic
1045008333 8:97935773-97935795 CACTTACAGGCCAGGCACAGTGG - Intronic
1045434406 8:102146799-102146821 AGGCCACAGCCCAGGGACACAGG + Intergenic
1045703850 8:104897601-104897623 CAGTGAGAGCACATGGACACAGG + Intronic
1045980358 8:108179332-108179354 AAGTCACAGCCCAAGGACACAGG + Intergenic
1047121795 8:121913107-121913129 CAGTTACAAAACATGGACACAGG + Intergenic
1047523253 8:125611916-125611938 CAGTCCCAGCCCAGAGAAACAGG - Intergenic
1047896899 8:129376268-129376290 AGGTCACAGCCCAGGGATACAGG + Intergenic
1049035684 8:140074243-140074265 CCCCTCCAGCCCAGGGACACTGG + Intronic
1049456585 8:142694768-142694790 CAGTCACAGCCCATGGTCACAGG - Intergenic
1049740636 8:144239330-144239352 CGGTTACAGCATAGGGAGACGGG - Exonic
1049749486 8:144276547-144276569 CCGTGTCAGCCCAGGGACAGAGG - Intronic
1050123236 9:2330078-2330100 CAATGACAACACAGGGACACAGG - Intergenic
1050342347 9:4653640-4653662 CATTTACAGGCCAGGCACAGCGG + Intronic
1051241547 9:15062136-15062158 CAATGAGAGCCCATGGACACAGG - Intergenic
1051647757 9:19286916-19286938 CAGTTACAGCCAAGGAATTCTGG - Exonic
1051981362 9:23023518-23023540 AGGTCACAGCCCAAGGACACAGG - Intergenic
1052556169 9:30020773-30020795 CAGTGAGAGCGCATGGACACAGG - Intergenic
1054735893 9:68749432-68749454 CAGTTTCAGCCCAGTGACATTGG + Intronic
1055581374 9:77710444-77710466 AATTCACAGCCCAGGGGCACAGG - Intergenic
1055875790 9:80939921-80939943 AAGTCATAGCCCAGGAACACAGG + Intergenic
1056378785 9:86038576-86038598 CATTCACAGCCAAGGGACTCAGG + Intronic
1057532135 9:95858332-95858354 GAGTGACATCCCAAGGACACAGG - Intergenic
1057739540 9:97699492-97699514 CAGCTGCAGCCGAGTGACACTGG - Intergenic
1059774980 9:117465471-117465493 CAGAAATGGCCCAGGGACACTGG + Intergenic
1059961565 9:119570070-119570092 CAATAACAACCCATGGACACAGG + Intergenic
1059982898 9:119792740-119792762 CAGTTACAGCTCTGGGGTACTGG - Intergenic
1060977293 9:127772109-127772131 CAATTACAGCTCAGAGACAGAGG + Intronic
1061133999 9:128723192-128723214 CCCTTACAACCAAGGGACACAGG - Intronic
1061161091 9:128894503-128894525 CAGTAACAGACCAGGTACAGTGG + Intronic
1061756902 9:132820584-132820606 GAGTTAAATCCCAGGGTCACAGG + Intronic
1061817635 9:133206269-133206291 CAGACACAGCAGAGGGACACAGG + Intronic
1062372421 9:136246966-136246988 CAAATGCAGGCCAGGGACACTGG - Intergenic
1187043733 X:15624858-15624880 CAATTAGAGCACATGGACACAGG + Intergenic
1187167905 X:16822049-16822071 CAGTTACAGGCCAGGCATAGTGG + Intronic
1187181628 X:16947702-16947724 AAGTTGCAGAACAGGGACACGGG + Intronic
1191198413 X:57750051-57750073 CAATGAGAGCACAGGGACACAGG + Intergenic
1191704328 X:64078442-64078464 AAGTTATAGCCCAAGGTCACAGG - Intergenic
1192633276 X:72793018-72793040 AAGATCCAGGCCAGGGACACGGG - Intronic
1192648433 X:72927783-72927805 AAGATCCAGGCCAGGGACACGGG + Intronic
1192988457 X:76426236-76426258 CAATTACAACACATGGACACAGG + Intergenic
1193153865 X:78152637-78152659 CAGTTAGAACACATGGACACAGG - Intergenic
1193863262 X:86697122-86697144 AAGTCACAGCCCAAGGATACAGG + Intronic
1194105166 X:89759662-89759684 CCGTTACAGCCCAGGACCCCGGG - Intergenic
1194105617 X:89763198-89763220 AGGTCACAGCCCAGGGACACAGG - Intergenic
1194446308 X:93991413-93991435 CAGTGAGAGCACATGGACACAGG + Intergenic
1194647068 X:96470969-96470991 CAGTTAAAGAGCAGGAACACTGG - Intergenic
1195219072 X:102729371-102729393 AAATCAAAGCCCAGGGACACAGG + Intronic
1195997131 X:110742397-110742419 CTGTTTCAGCCCAGGGAGATGGG - Intronic
1196480840 X:116145810-116145832 AATTCACAGCCCAGGGACATAGG - Intergenic
1196853414 X:119960800-119960822 AGGTCACAGCCCAGGGACACAGG - Intergenic
1196858893 X:120008891-120008913 AGGTCACAGCCCAGGGACACAGG + Intergenic
1197038068 X:121902337-121902359 AAGTTACAGCCCAGATACACAGG - Intergenic
1197617895 X:128715077-128715099 CAGCTGCAGCCAAGTGACACTGG - Intergenic
1198150192 X:133900748-133900770 CAGTTACAGCCCATGTTCTCTGG + Intronic
1199846915 X:151698364-151698386 GAGATACAGCCCAGAGAGACGGG - Exonic
1200457580 Y:3411023-3411045 AGGTCACAGCCCAGGGACACAGG - Intergenic
1201278750 Y:12322184-12322206 CAGTTGCAGGCCTGGGACCCTGG + Intergenic
1201351510 Y:13047702-13047724 AAGTCACAGCCCGGGGGCACGGG + Intergenic