ID: 1093187415

View in Genome Browser
Species Human (GRCh38)
Location 12:16036830-16036852
Sequence AAAATTGGGCAGTAGGTAAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 137}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093187415 Original CRISPR AAAATTGGGCAGTAGGTAAC TGG Exonic
902107426 1:14049504-14049526 AAAATTGTTCAGTAGGCAGCAGG - Intergenic
906417688 1:45633923-45633945 AAAAGTGGGCAGTGGCTAAATGG - Intronic
908375567 1:63536092-63536114 ATAATTGGGAATTAGGTAAAAGG + Intronic
910029316 1:82697954-82697976 AAATTTAGGCATTAGGAAACAGG - Intergenic
910199776 1:84687770-84687792 AACATTGACCAGTAGGTTACAGG - Intronic
910273349 1:85420764-85420786 AAAATGTGGAATTAGGTAACAGG - Intronic
915468124 1:156109609-156109631 AAAACTAGGCCGTAAGTAACAGG - Intronic
917679108 1:177348160-177348182 AAATTTGGGCAGAAGATAACTGG - Intergenic
919197368 1:194304239-194304261 AAAAGTGGGTAGTAGGAAAATGG + Intergenic
1064742330 10:18446422-18446444 ATACTTGGGCAGTAAGTAGCAGG + Intronic
1066098904 10:32099393-32099415 CAAATTTGGAAGTAGGTAACAGG - Intergenic
1068221444 10:54051225-54051247 CAAATTTGGAAGTGGGTAACAGG + Intronic
1068504638 10:57884706-57884728 AAAATAGGGCAGTAGGTTGGAGG - Intergenic
1069132645 10:64726302-64726324 AAAACTGTGTAGTAAGTAACAGG - Intergenic
1073308128 10:102519188-102519210 AAAATGGGACAGCAGGTGACAGG + Intronic
1074646428 10:115458293-115458315 AAAATTGTGCAGTTGGTTTCTGG + Intronic
1074989677 10:118692183-118692205 ATAAGTGGGCTGGAGGTAACTGG + Intronic
1075436399 10:122446678-122446700 AAAATTGGGAAGAAGGTAAAAGG - Intergenic
1080220418 11:29896508-29896530 CAAATTGGGCAGGAGCTAAAAGG + Intergenic
1082909201 11:58351047-58351069 AAAAATAGGCAGAAGGTACCTGG - Intergenic
1084653784 11:70503653-70503675 CAAATAGGGCAGGAGGTAACCGG - Intronic
1087984516 11:104660678-104660700 AAAATGAGGCAATAGGAAACTGG + Intergenic
1088338139 11:108731385-108731407 AAAATTCGAAAGTAGGTAACAGG - Intronic
1088724910 11:112625540-112625562 ATAAAAGGGCAGTAGGAAACAGG + Intergenic
1090018008 11:123102851-123102873 AAAATTGGGCAGGAGGAGGCTGG - Intronic
1092783367 12:12007343-12007365 TAAAATGGGGAGTAGGTAACAGG + Intergenic
1093187415 12:16036830-16036852 AAAATTGGGCAGTAGGTAACTGG + Exonic
1099092993 12:78337585-78337607 AAATTTGGGCATTAGCTACCTGG + Intergenic
1099921459 12:88962459-88962481 TAAACTGGGCAGTGGGTAAATGG - Intergenic
1100551467 12:95650035-95650057 AAAATTGGGAAGTGGGAAAGTGG + Intergenic
1100688647 12:97014331-97014353 AAAATTGGGCAGGTGGAAACTGG + Intergenic
1104849081 12:131862652-131862674 AAAATTGAGCAGAAGGTAGAGGG + Intergenic
1106000845 13:25721626-25721648 AGAAATGGGAAGTAGGTAAGTGG - Intronic
1106305482 13:28505474-28505496 AAAATTGGGAAGTCTGCAACAGG + Intergenic
1107509134 13:41064189-41064211 AAAATTTAACAGTATGTAACTGG + Intronic
1109551794 13:63913233-63913255 AAAATTTGAAAGTAGGAAACTGG + Intergenic
1110224707 13:73107453-73107475 AAAACTGTGAAGTAGGTAAAAGG - Intergenic
1111085232 13:83367523-83367545 AGAATTGGACAATTGGTAACTGG + Intergenic
1112294293 13:98172984-98173006 AAAAATGTGCAGTAGATAAGTGG + Intronic
1113776037 13:112945400-112945422 AAAATTGGGCAGAAAGTACAGGG - Intronic
1114129535 14:19774242-19774264 AAAATTAGGAATTATGTAACAGG + Intronic
1118810763 14:69271407-69271429 AAAACTGGGCATAAGGTGACAGG + Intronic
1118876300 14:69787659-69787681 AAAATTGTGAACTAGGTAATAGG + Intronic
1119504477 14:75160321-75160343 AAAATTAGGGAATAGGAAACTGG + Intronic
1121809744 14:96873862-96873884 AAAGTTGGGCAGGAGTTACCTGG + Intronic
1122805646 14:104255241-104255263 AAAATTGGACAGGAGGGAAGGGG - Intergenic
1124440938 15:29685825-29685847 AGAATTGCTCAGTAGATAACAGG + Intergenic
1127975414 15:63993432-63993454 AAAATTGGGCAAGAAATAACTGG - Intronic
1130562612 15:84970459-84970481 AAAAGTGGGAAGTAGGTGAGGGG + Intergenic
1131619917 15:94057333-94057355 AGAATTGGACAGAAGGTAAGAGG + Intergenic
1134289222 16:12890258-12890280 AAAAATGGGAAGAAGGTAAGAGG + Intergenic
1141397238 16:83716141-83716163 AAAATTGAGCAGAAGGTACAGGG + Intronic
1141413532 16:83852932-83852954 AGGAGTGGGCGGTAGGTAACTGG - Intergenic
1145064369 17:19752190-19752212 AAAATTAGGCAGTGGGTCTCAGG + Intergenic
1146690958 17:34875809-34875831 AAAATAAGGCAGTAGGAGACAGG - Intergenic
1149185796 17:53995906-53995928 GAAGTGGGTCAGTAGGTAACTGG + Intergenic
1157114873 18:44853128-44853150 AAAGGTGGGCAGGAGGTGACTGG - Intronic
1159655050 18:71023355-71023377 AATATTTGGTAGTAGCTAACAGG + Intergenic
1163079998 19:14932223-14932245 ACATTTGAGCAGTAAGTAACAGG - Intergenic
1164086234 19:21905173-21905195 CAAATTTGGAACTAGGTAACAGG - Intergenic
1164885134 19:31772208-31772230 AAAATTGTGCAGCAGGTTTCAGG - Intergenic
1164946295 19:32295850-32295872 AAAAGTGGCCAGGAGGTAGCAGG - Intergenic
1165330960 19:35141047-35141069 TAAATTGGGAAGGAGGGAACAGG - Intronic
1167950631 19:53024439-53024461 AAAAATTGGCAGTATTTAACAGG - Intergenic
925062269 2:902251-902273 AAAATTGGGCAGAAGACAAGAGG + Intergenic
925468964 2:4138518-4138540 AAAAGTGGGCATTAGGTATGGGG - Intergenic
927555213 2:24026122-24026144 AAAATTGGTGTGTAAGTAACAGG + Intronic
928843154 2:35635390-35635412 CAAATTGGGAATTAGGTGACAGG + Intergenic
928922972 2:36544672-36544694 AAAATAAGTCAGCAGGTAACTGG + Intronic
930295131 2:49544757-49544779 AAATTTGGGCAATAGGTATGTGG - Intergenic
933369604 2:81398193-81398215 AAAATAAGTCACTAGGTAACTGG + Intergenic
936931381 2:117792857-117792879 AAATGTTGGCATTAGGTAACAGG + Intergenic
937865933 2:126751936-126751958 AAAGTTGGGTAGGAGTTAACTGG + Intergenic
943210635 2:184961213-184961235 AAAATTGTGCACTAGGAAAAGGG + Intergenic
944646636 2:201786873-201786895 AAAATAGTGCAGTAGCTAAAAGG + Intergenic
947510691 2:230751551-230751573 AAAGATGGGCAGTACCTAACAGG + Intronic
1169678009 20:8176748-8176770 AAAATTGGGTAAAAGGTAAAAGG + Intronic
1169902766 20:10570201-10570223 AAGGTGGGGCAGTTGGTAACTGG - Intronic
1170754177 20:19184069-19184091 AAAATTGGGCAGAAGGTATGTGG + Intergenic
1172697475 20:36832466-36832488 AGAATGGGGCAGAAGGGAACTGG - Intronic
1173922302 20:46755496-46755518 GAAATGGGGCAGAAGGTACCAGG - Intergenic
1177130342 21:17247669-17247691 CAAATTTGGAAGTGGGTAACAGG + Intergenic
1179429539 21:41310399-41310421 AAAATGAGGCAGTAGCTCACGGG - Intronic
1180237870 21:46475670-46475692 AAAATTGGGTGGTAGGTACGTGG - Intronic
1181921157 22:26321424-26321446 CAAATTGGGCAGCAGGAAAAGGG + Intronic
1183183584 22:36278243-36278265 AAAATTGGGCCCTGAGTAACAGG + Intergenic
949293000 3:2487035-2487057 AAAAGTGGGGAGAAGGTAGCAGG - Intronic
949897181 3:8776663-8776685 GAAATGGGGCAGGAGCTAACGGG - Intronic
954282556 3:49592784-49592806 AAAATTGGGCAAAATGTAAAAGG - Intronic
955200330 3:56846300-56846322 AAAATGGGGCAGGAGGAAATAGG + Intronic
965294129 3:166921463-166921485 AAAATGGGGAAAAAGGTAACAGG - Intergenic
966014770 3:175128593-175128615 AAAATTGTGCAGTAGGTATAAGG + Intronic
970396936 4:15677805-15677827 AAACTTGGGGAGTAGGTCATGGG + Intronic
971525588 4:27613755-27613777 GAAGCTGAGCAGTAGGTAACCGG - Intergenic
974532525 4:63128188-63128210 AAGAGTAGGCAGTAGCTAACAGG - Intergenic
974624480 4:64404737-64404759 GAATTTGAGCAGTAGGTAAAAGG + Intronic
978166834 4:105619416-105619438 ACAATTGGGCAGCATTTAACTGG - Intronic
978637887 4:110832468-110832490 ACAATGGGGCAGAAGGCAACTGG - Intergenic
979701507 4:123673432-123673454 AAAAATAGGGAGTAGGTGACTGG + Intergenic
981594179 4:146400390-146400412 AAAATAGGGCAGTGGCTAAAGGG + Intronic
981648206 4:147024100-147024122 AAAAATGGCCAGTGGGTATCTGG + Intergenic
981974586 4:150710308-150710330 AAAATGGAGGAGTAGTTAACAGG + Intronic
982407525 4:155036677-155036699 AAATCTTGGCAGTAGGTATCTGG - Intergenic
984034844 4:174652519-174652541 AGAATTGTGCAGTAGCTAAATGG - Intronic
986133046 5:4948483-4948505 AAAACTGTGCAGTTGGTAATTGG + Intergenic
987211828 5:15691604-15691626 AAAAGTGGGCAAAAGGTAACAGG - Intronic
987413618 5:17639689-17639711 AAAATTGGGCAGAAGGAACAGGG + Intergenic
988696165 5:33624445-33624467 AAGACTGGGCAGGAGGTACCAGG + Intronic
990654482 5:57939959-57939981 AAAATTGGGCAGGACATCACAGG + Intergenic
991954200 5:71976116-71976138 AAAATTGGGCATTTGGAAAGAGG - Intergenic
992251000 5:74875963-74875985 AAAATGGGGGAGTAGGGAAGAGG + Intergenic
993016771 5:82543592-82543614 AAACTTTGGAAGTAGGTAACAGG + Intergenic
996218533 5:120898786-120898808 AAAATTTGGCAGTTGGTAGAGGG - Intergenic
997125574 5:131223743-131223765 AAAATTGGGCAGTAGATAGAGGG - Intergenic
997361104 5:133295484-133295506 AGAATAGGGCAGTAGCTAAAAGG - Intronic
1001721744 5:173862542-173862564 AAAATAGGGCAGAAGGTGATGGG + Intergenic
1001894107 5:175363871-175363893 AAACATGGGCAGCAGGTGACAGG + Intergenic
1004089367 6:12484793-12484815 ATAATTGGACAGTATGTCACAGG - Intergenic
1006421545 6:33937208-33937230 CATATTAGGCAGTAAGTAACAGG - Intergenic
1006875415 6:37291160-37291182 TAAATTGTGAAGTAGGTAAACGG + Intronic
1007934358 6:45720084-45720106 AACATTGGGCAGGAGGTGAAGGG - Intergenic
1009271202 6:61616368-61616390 ATAATTGGGCAGTGGTTAGCTGG + Intergenic
1010471187 6:76230325-76230347 AGAATTGGGCAGTAGTGAGCAGG - Intergenic
1013594980 6:111652256-111652278 AGAATTGTGCAGTATGCAACTGG - Intergenic
1014268207 6:119306187-119306209 AAAATTTGTCTGTAAGTAACAGG - Intronic
1017128405 6:151087298-151087320 AAAATTGTGATGTAGTTAACTGG + Intronic
1020378771 7:7518585-7518607 AAAATTAGGCAATAAGTAAGAGG - Intronic
1020516125 7:9121921-9121943 AATATTGGGGAGCAGGTAAAAGG - Intergenic
1021506078 7:21386545-21386567 AGAAATGGGCAGTAGGTTCCAGG + Intergenic
1024320315 7:48059754-48059776 AAAGCTGGGCATTAGGAAACTGG + Intronic
1024981905 7:55164442-55164464 TAAATTGGGCAGAAGATGACAGG + Intronic
1028745414 7:94321268-94321290 CAACTTTGGAAGTAGGTAACAGG - Intergenic
1033001918 7:137514819-137514841 GAAATAGGGCAGCAGGTACCAGG - Intronic
1035712384 8:1728520-1728542 AAAATTGGGCAGAAAGTACAGGG - Intergenic
1038918735 8:32057584-32057606 AAACATGGGCAGTGGGGAACAGG - Intronic
1041801729 8:61807682-61807704 AAAAGTGAGGTGTAGGTAACAGG - Intergenic
1050099065 9:2099293-2099315 GAAATGGGACAGTGGGTAACAGG - Intronic
1050172987 9:2842244-2842266 AAAACTGAGCAAGAGGTAACAGG - Intronic
1051118204 9:13721836-13721858 AAAATAGGTAGGTAGGTAACAGG + Intergenic
1051278093 9:15416389-15416411 AAAACTGGGGAGTAGGAAAAGGG - Intergenic
1052331555 9:27275044-27275066 AGAATTGGGGAGGGGGTAACAGG + Intergenic
1057515044 9:95713673-95713695 AAAATTGGTCAGGAGGTATTAGG + Intergenic
1058136823 9:101316682-101316704 AAAAGTGGGCAGTAACTTACAGG + Intronic
1058428356 9:104895911-104895933 AAAATTGGGCCTTAGGCAAGAGG + Intronic
1060867496 9:127011766-127011788 AAAATTGGTTTGTATGTAACAGG + Intronic
1061345315 9:130019598-130019620 CAAATTTGGCAATAGTTAACTGG + Intronic
1187486071 X:19705574-19705596 AAAATTCGGAAGTAGGTAAAAGG + Intronic
1188150116 X:26663273-26663295 ATAATTGGGTAGTAGGTCAGTGG + Intergenic
1188659609 X:32742700-32742722 GACATTGGGCAGTAGGTATAAGG + Intronic
1192309326 X:69997097-69997119 CAACTTTGGAAGTAGGTAACAGG + Intronic
1196556624 X:117092378-117092400 AATATTGGTTAGTAGGTAATTGG + Intergenic