ID: 1093203071

View in Genome Browser
Species Human (GRCh38)
Location 12:16213251-16213273
Sequence TAGTAAGTGTTCAGTAAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 1, 1: 0, 2: 10, 3: 52, 4: 341}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093203071 Original CRISPR TAGTAAGTGTTCAGTAAAGA TGG (reversed) Intronic
901644928 1:10711463-10711485 TAGCAAGTGCTCAATAAATATGG + Intronic
902893204 1:19460205-19460227 TAGTAAGTGCTTAGTTAAGATGG + Intronic
903165257 1:21515719-21515741 TAGTAAAGGTGCACTAAAGAAGG - Intronic
903531573 1:24034570-24034592 TGGTAAGTGCTTAGTTAAGATGG + Intergenic
904455596 1:30646251-30646273 TAATATGTGCTCAGTAAACAGGG - Intergenic
904843559 1:33390548-33390570 TAGTAATTGTTCAATAAATATGG - Intronic
905747568 1:40431975-40431997 TATTGAGTGTTCAATCAAGAAGG - Intergenic
905811157 1:40914237-40914259 TTGTATGTTTTCAGTACAGATGG - Intergenic
906349105 1:45041838-45041860 TAGTAAGTTTTTACTAAAAATGG + Intronic
906581533 1:46939280-46939302 TAGTATGTGTGCAGTAAGCATGG - Intronic
906602187 1:47139616-47139638 TAGTATGTGTGCAGTAAGCATGG + Intronic
906895594 1:49767156-49767178 TATTCAGTGTTCAGATAAGAAGG - Intronic
907460442 1:54602358-54602380 TAGTGAGTGCTCAGTAAATGTGG + Intronic
907788004 1:57633015-57633037 CAGTAAGTATTCAGTAAACATGG + Intronic
909250619 1:73350033-73350055 TAGTAGGTGTTCAATAAATGTGG + Intergenic
909856277 1:80536487-80536509 AAGTAAGTGTTCTGGGAAGAGGG - Intergenic
910001996 1:82352561-82352583 TAATATTTGTGCAGTAAAGAAGG - Intergenic
910107980 1:83652217-83652239 GAGTTGGTGTTCAGCAAAGAAGG + Intergenic
910171925 1:84386983-84387005 GAGAAAGTGTTCAAGAAAGACGG - Intronic
910423147 1:87090880-87090902 GAGAAAGTGTTCTGGAAAGATGG - Intronic
910905546 1:92173828-92173850 TAGTAAGTGCTCAATAAATGTGG + Intronic
911382661 1:97135271-97135293 TATTAAGTGTTCATTAAATATGG + Intronic
912401798 1:109398975-109398997 TAGAAATTGTTCAGTAGAAAAGG + Intergenic
912833654 1:112976331-112976353 TAGTAGGTATTCAATAAAGATGG - Intergenic
913198868 1:116479818-116479840 TGGTAAGTGTTTAGTTAAGCTGG - Intergenic
914350886 1:146839188-146839210 TTGTATGTTTTTAGTAAAGATGG - Intergenic
914419837 1:147519201-147519223 TGGTTAGTGTTCAGGAAAGGTGG - Intergenic
917051407 1:170928719-170928741 TAATAAATCTTCATTAAAGAAGG + Intergenic
917206779 1:172582739-172582761 TAGGCAGTGTTCTGTAAACATGG + Intronic
917317722 1:173743492-173743514 TAGTAAGTGTTCAGGAATAAAGG - Intronic
917512425 1:175679374-175679396 CAGTAGGTGTTCAGTAAATATGG - Intronic
918629981 1:186705026-186705048 TAGTAAATCTTTACTAAAGAAGG + Intergenic
918740275 1:188121820-188121842 TGGTATGTTTTTAGTAAAGACGG + Intergenic
919070468 1:192749083-192749105 AAGTATTTGTTCATTAAAGAAGG - Intergenic
919502799 1:198358681-198358703 TAGTATGTGTTCAGAAAACATGG + Intergenic
919814164 1:201427301-201427323 CAGTAAGTGTTCAGTAAATGGGG + Intronic
919839139 1:201596659-201596681 TAGTAGATGTTCAATAAATATGG - Intergenic
920531355 1:206705053-206705075 TAATAAGTGCTAAGTAAAAAGGG - Intronic
921600260 1:217099153-217099175 GAGTAGGTGTTCAATAAACATGG + Intronic
922198087 1:223376944-223376966 TAGTAAGTGCTCAGGAAAGTAGG + Intergenic
923371817 1:233322132-233322154 AAGTTAGTGTCCAGGAAAGAAGG - Intergenic
1063205714 10:3828939-3828961 TAGTAATTTTTCAGAAACGAGGG - Intergenic
1067511154 10:46895947-46895969 TGGTAAGTGTTCTGTGAAAATGG - Intergenic
1067651098 10:48155915-48155937 TGGTAAGTGTTCTGTGAAAATGG + Intergenic
1067785167 10:49240463-49240485 CAGTAAGTGCTTAGTAAATATGG + Intergenic
1068038126 10:51786794-51786816 TAGTAAGTGTTGATACAAGAAGG - Intronic
1068927040 10:62551251-62551273 TAATAAGTGTTATGTAAAGATGG - Intronic
1068998697 10:63239140-63239162 TAATAAGAGATCAGAAAAGAAGG + Intronic
1069600727 10:69705143-69705165 TTTTAAGTGTTCTGTAGAGATGG + Intergenic
1070018375 10:72558447-72558469 CAGTAAGTGTGCAGAAAAGGAGG + Intronic
1071903097 10:90141634-90141656 TAGTAAATGTTCAGTAAATAAGG + Intergenic
1073799220 10:107023053-107023075 CAGTATGTGTTCAGTAGAGAGGG + Intronic
1073990707 10:109259327-109259349 TAGTAAGTGTTCAATGCAGGAGG + Intergenic
1074304592 10:112264937-112264959 TTGTATGTATTCAGTAGAGACGG - Intergenic
1074675092 10:115839460-115839482 TAGGAAATATTCTGTAAAGAGGG - Intronic
1075629837 10:123994365-123994387 TTGTAAGGGTTCAGAAGAGAGGG + Intergenic
1075922778 10:126226688-126226710 TAGTAAGTGTTCAGTAATTGAGG + Intronic
1075922779 10:126226718-126226740 TAGTAAATGTTCAGTAATTGAGG + Intronic
1077642020 11:3889916-3889938 TAGTAAATATTAAGCAAAGACGG + Intronic
1078343540 11:10521641-10521663 TAGTAAGTGCTAAGTAAAGAAGG + Intronic
1079365874 11:19809136-19809158 TAGTAACTGTTCAGGATAAAAGG - Intronic
1080184137 11:29459206-29459228 CAGTAAGTGTTCAGTGAAACAGG + Intergenic
1081264575 11:41004313-41004335 TAGCAAAAGTTCAGGAAAGATGG - Intronic
1081460125 11:43264920-43264942 TTGTATTTGTTTAGTAAAGACGG - Intergenic
1081501784 11:43673958-43673980 TATTAAGTGTTCAGTGAGGTAGG - Intronic
1083774775 11:64889027-64889049 TAGTAGGTGTTCAGGATACATGG - Intergenic
1084770709 11:71341316-71341338 TGGAGAGTTTTCAGTAAAGATGG - Intergenic
1085176703 11:74494007-74494029 TTTTAAGTGTTAAGTAAATAAGG + Intronic
1085348542 11:75783641-75783663 TAGTGGGGGTTCAGCAAAGAGGG + Intronic
1085655546 11:78311212-78311234 TAATAAGTGTTCAGTAAATATGG - Intronic
1085789194 11:79482175-79482197 TATTAAGTGTTCAGCAAACGTGG + Intergenic
1087335269 11:96836198-96836220 TAGTAAGTGTTCATTAAATATGG - Intergenic
1088523760 11:110728907-110728929 TAGTAAGTGATAACTCAAGAGGG - Intergenic
1089310499 11:117555320-117555342 TGGCAAGTGCTCAGTAATGATGG + Intronic
1089549696 11:119263568-119263590 TAATATGTGTTTAGTAAAAAGGG + Intronic
1090644473 11:128756723-128756745 AAGTAAGTCTTCAGAGAAGATGG - Intronic
1091036761 11:132241379-132241401 TGGTAACTATTCAGTAAAAACGG - Intronic
1092060552 12:5547075-5547097 TAGCAGGTGTTCATTAAAGTGGG + Intronic
1093203071 12:16213251-16213273 TAGTAAGTGTTCAGTAAAGATGG - Intronic
1094083503 12:26563644-26563666 CAGTAAATGTTAAGTAAGGAGGG - Intronic
1094580494 12:31729525-31729547 TAGAAAGTGCTCAGTAAACTCGG - Intergenic
1094815323 12:34178176-34178198 TAGTAAGTTTTCAGGAGAGCTGG - Intergenic
1097057986 12:56261671-56261693 AAGGAAGGGTTCAGTCAAGAGGG + Intergenic
1097989437 12:65819540-65819562 TATTAAGTGCTCAATAAATAGGG + Intergenic
1099254764 12:80301886-80301908 TGGTAAGTGCTTAGTTAAGACGG - Intronic
1099736523 12:86573666-86573688 TAGTATGTGTTCACTAAATGTGG + Intronic
1099872012 12:88361292-88361314 TAGTAAGTGCTTTGTTAAGATGG - Intergenic
1099976506 12:89551177-89551199 TAGTATGGATTCAGGAAAGAAGG - Intergenic
1100412302 12:94331983-94332005 TAGGAAGTGCTCAGTAATGGTGG - Intronic
1100430313 12:94526373-94526395 TAAAAAATGTTCAGTAATGAAGG - Intergenic
1100975911 12:100122480-100122502 TAGTAAATGCTCAGTAAATATGG - Intronic
1101092539 12:101302361-101302383 TAGCAAGTATTCAATAAATAAGG + Intronic
1101443089 12:104718091-104718113 TAGTAAGTGCTCAATAAAGATGG - Intronic
1101986265 12:109449867-109449889 TATTAAGTGCTAAGGAAAGAGGG - Exonic
1102048068 12:109842114-109842136 TAGTAAGTGCTCAGCAAACAGGG + Intergenic
1102531794 12:113552077-113552099 TAGCAGGTGCTCAGTAAACATGG + Intergenic
1103096296 12:118135605-118135627 TTTTAAGTTTTCTGTAAAGACGG + Intronic
1103935095 12:124471418-124471440 TAGTAGGTGCTCATTAAAAATGG - Intronic
1104757859 12:131279999-131280021 TAATGAGAGTTCAGTAAAGTTGG - Intergenic
1105424259 13:20281673-20281695 TAGTACATGCTCAGTAAAAATGG + Intergenic
1106222048 13:27754384-27754406 TAGTAAATGTGCAGTAAATGGGG + Intergenic
1106470492 13:30049949-30049971 TGGCAAGTGTTCACTAAATATGG - Intergenic
1107216742 13:37930131-37930153 AAGTAAGTTTTCTCTAAAGAAGG - Intergenic
1107716919 13:43209329-43209351 TATTAAGTATTTAGTAGAGATGG + Intergenic
1107812579 13:44214599-44214621 TTGTCATTGTTCAGAAAAGATGG - Intergenic
1107871050 13:44746798-44746820 TAGTAAATGCTCAGTAGATATGG - Intergenic
1108893748 13:55296059-55296081 TAGTAATCATTCAGTAAATATGG + Intergenic
1109480943 13:62951819-62951841 AAGGAAAGGTTCAGTAAAGAGGG + Intergenic
1109636076 13:65119464-65119486 TTGTAAGTGCTCATTAAACATGG + Intergenic
1109932370 13:69232940-69232962 TAGTATGTTTTTAGTAAAGATGG + Intergenic
1110397643 13:75049998-75050020 TAGTAACTGATCAGCATAGAAGG + Intergenic
1114046207 14:18878545-18878567 TTGTAAATTTTTAGTAAAGACGG - Intergenic
1114118003 14:19640905-19640927 TTGTAAATTTTTAGTAAAGACGG + Intergenic
1114976381 14:28105728-28105750 GAGGATGTGTTCAATAAAGAAGG - Intergenic
1116133120 14:40885459-40885481 TAGTAAGTAATCAATAGAGATGG - Intergenic
1116498757 14:45594625-45594647 TTGGAATTGTTCAGAAAAGAGGG + Intergenic
1116612046 14:47087882-47087904 TGGTTAGTGTCCAGAAAAGAGGG - Intronic
1117102385 14:52363806-52363828 TTTTATGTTTTCAGTAAAGACGG + Intergenic
1117269965 14:54133666-54133688 CAGTAAGAGTTAAGTAGAGATGG + Intergenic
1117352189 14:54892162-54892184 TGGTAAGTGCTTAGTTAAGATGG + Intronic
1117677330 14:58168078-58168100 TTGTAAGTGTTCAGCAGAGTGGG - Intronic
1119324027 14:73747977-73747999 TAGTAAGTGCTCAGTAAACATGG - Intronic
1119474502 14:74919357-74919379 CAGTAAGTGTTCAGTGAGGGTGG - Intronic
1120078976 14:80193525-80193547 TAGAAAGGGTGCAGGAAAGAAGG + Intergenic
1120263832 14:82224108-82224130 TAGTTTGTTTTCAGTAGAGAGGG - Intergenic
1121097410 14:91227362-91227384 TGGTAAGTGATCAGTTAAGATGG + Intergenic
1127655375 15:61050726-61050748 TAGTAAGTGCTCAATAAAGCAGG - Intronic
1130542852 15:84834506-84834528 TAGTAAGTCTTCATTAATGTTGG + Intronic
1130757221 15:86777834-86777856 TAGTAAGTCTTGATTACAGAGGG + Intronic
1130769070 15:86906223-86906245 TAGAAAGTCTTCAGGAAAGAAGG + Intronic
1131214818 15:90528791-90528813 GTGTCAGTGTTCTGTAAAGAGGG - Intergenic
1131985079 15:98034736-98034758 AACCAAGTGTTCAGTAAAAAGGG + Intergenic
1134222097 16:12362900-12362922 TGGTAGGTGTTCAGTAAATGTGG + Intronic
1135354491 16:21757941-21757963 TAGTAGGTGCCCAGTAAACATGG - Intronic
1135452981 16:22574081-22574103 TAGTAGGTGCCCAGTAAACATGG - Intergenic
1135894772 16:26389276-26389298 TAGTAATTGATTAGGAAAGAAGG - Intergenic
1136146502 16:28319633-28319655 TAGTAGGTGCTCAGCAAAGAAGG - Intronic
1136318518 16:29467609-29467631 TAATAAGGGTTCAGGAAAGGGGG - Intronic
1136433093 16:30206958-30206980 TAATAAGGGTTCAGGAAAGGGGG - Intronic
1138511960 16:57513911-57513933 TAGTAAATGCTCAATAAATAAGG + Intronic
1139983150 16:70876356-70876378 TTGTATGTTTTTAGTAAAGATGG + Intronic
1140162311 16:72510244-72510266 TAGTAATTATTCAGGAATGAGGG + Intergenic
1140254423 16:73322733-73322755 TAGTGGGCGTTCAGTAAATAGGG - Intergenic
1140792723 16:78407922-78407944 TAGAAAGTGTTAAGTAATGTAGG + Intronic
1141643331 16:85354410-85354432 TAGTAGGTGCTCAGTAAAAAGGG + Intergenic
1142921502 17:3191052-3191074 GACAAAGTGTTCAGTAATGAGGG - Intergenic
1143003062 17:3807772-3807794 TAGCAGGTCTTCTGTAAAGATGG - Intergenic
1143573146 17:7773602-7773624 TAATAAGTGCTTAGTTAAGATGG - Intronic
1144384569 17:14737426-14737448 TAGTAGGTGTTCAGAAACAAAGG - Intergenic
1146687602 17:34851974-34851996 TAGTAGGTGCTCACTAAAGAAGG + Intergenic
1146958546 17:36952401-36952423 TAATAAGTATTTAGTAAATAGGG + Intronic
1147366310 17:39961679-39961701 AAGGAAACGTTCAGTAAAGATGG + Intergenic
1147929403 17:43968309-43968331 TAGGAAGTGTGCAGTAGAGCGGG + Intronic
1148172849 17:45537766-45537788 TATAAAGTGCTTAGTAAAGATGG + Intergenic
1148276418 17:46307684-46307706 TATAAAGTGCTTAGTAAAGATGG - Intronic
1148298535 17:46525259-46525281 TATAAAGTGCTTAGTAAAGATGG - Intronic
1148363071 17:47029735-47029757 TATAAAGTGCTTAGTAAAGATGG - Intronic
1149086050 17:52717325-52717347 TGGGAAGAATTCAGTAAAGAAGG - Intergenic
1149447740 17:56726523-56726545 TAGTAAGTGCTCAGTAAATGTGG - Intergenic
1149715546 17:58785820-58785842 TGATAAGTGCTCAGTTAAGATGG - Intronic
1149941549 17:60874013-60874035 GAATAAGTCTACAGTAAAGATGG - Intronic
1150404055 17:64884689-64884711 TATAAAGTGCTTAGTAAAGATGG + Intronic
1150783543 17:68143376-68143398 TATAAAGTGTTTAGTAAAGGTGG + Intergenic
1151117579 17:71755461-71755483 TAATAAGTGCTCAGTGAATATGG - Intergenic
1151377896 17:73703935-73703957 CAGAATGTGTTCAGTAGAGAGGG + Intergenic
1152056855 17:78035433-78035455 TAGTAGGTGTTGAGTAATGCAGG + Intronic
1152065305 17:78109266-78109288 GACTGAGTGTTCAGTGAAGAGGG + Intergenic
1153365361 18:4249541-4249563 CAGTAACCGTTCAGTAATGATGG + Intronic
1153958715 18:10122256-10122278 TATTAACTGTGCAGTAAAGAAGG + Intergenic
1155096126 18:22558266-22558288 TAGTAAGTACTCAATAATGAAGG - Intergenic
1156167196 18:34436521-34436543 AATTAAGTTTTCATTAAAGATGG - Intergenic
1156178254 18:34573065-34573087 CAGTAGGTGCTCAGTAAACATGG + Intronic
1157281063 18:46346713-46346735 TGGGAAGTGTTTAGAAAAGATGG + Intronic
1158033165 18:52991855-52991877 TAGTAAGTGTTCAGTACAAAAGG + Intronic
1158196195 18:54887366-54887388 TAGTAAGTATTCAGTAAATACGG - Intronic
1158579097 18:58665931-58665953 TAGTAAACGTGCAGTAGAGAGGG - Intergenic
1158611078 18:58941637-58941659 TTTTAAGTTTTCTGTAAAGATGG + Intronic
1158805128 18:60962478-60962500 TAGTAAGTAGTCAATAAATATGG - Intergenic
1158883198 18:61800785-61800807 TAGTAGGTGCTCAGTAAATACGG - Intergenic
1159206292 18:65257124-65257146 GAGTAAATGTTCTGTAAAGAGGG - Intergenic
1160160671 18:76467541-76467563 AAGTAAGTGCTCAGTCAAGGAGG + Intronic
1160702315 19:513605-513627 CAGTAGGTGTTCAGTAATGCAGG - Intronic
1161923961 19:7287329-7287351 TTGTATTTTTTCAGTAAAGATGG + Intronic
1165398605 19:35582963-35582985 TAGTAGGTGCTCAGTAAACATGG - Intergenic
1165891503 19:39115270-39115292 TAGTAGGTGCTCAATAAACATGG + Intergenic
925533967 2:4895545-4895567 CTGTCAGTGTTCAGAAAAGAAGG - Intergenic
926023857 2:9521783-9521805 TAGTAAGTGTGAGATAAAGAAGG + Intronic
926837061 2:17034769-17034791 TAGTAAGAGATCAATAAATATGG + Intergenic
928365190 2:30695158-30695180 CATTAAGTGTTCAGTGAAGTTGG - Intergenic
930167897 2:48221229-48221251 TTGTATGTTTTCAGTAGAGACGG - Intergenic
930226916 2:48803465-48803487 TTGTTAGTGTTCAGTAATAAAGG - Intergenic
930738395 2:54803015-54803037 GAGTAAGTGGGCAGGAAAGAGGG - Intronic
931054213 2:58450392-58450414 TAATAAGTGCTCAGTAATGTTGG + Intergenic
932440077 2:71729178-71729200 CAGTAAGTGCTCAATAAATAAGG - Intergenic
932778170 2:74541081-74541103 TGGTACGTGTTCAGTACAGATGG - Intronic
933150911 2:78913812-78913834 TAGTTAGGGTTCATTATAGAAGG - Intergenic
933860921 2:86466756-86466778 TAATAACTGTTCAGGAAAAAAGG + Exonic
933918812 2:87023845-87023867 CAGTAAGTGGTCAGTAAATAAGG - Intergenic
934004182 2:87746071-87746093 CAGTAAGTGGTCAGTAAATAAGG + Intergenic
934509195 2:94923466-94923488 TAGTAAGTAGTCAGAAACGATGG + Intergenic
935767137 2:106380083-106380105 CAGTAAGTGGTCAGTAAATAAGG + Intergenic
936884037 2:117287628-117287650 TTGTATTTTTTCAGTAAAGACGG - Intergenic
939348676 2:141002648-141002670 GTGTAAGTGTTCAGTACAGAGGG + Intronic
939581893 2:143960387-143960409 TAGTCAGTGTTCCCTGAAGATGG - Intronic
939600600 2:144185008-144185030 TAAGAAGTGGTCAGGAAAGATGG - Intronic
940308868 2:152255691-152255713 TAGTAAGTGTTCAGAGAAGAAGG + Intergenic
940662391 2:156562972-156562994 TAGTAAGTGGTCTTTAATGATGG + Intronic
940806813 2:158196553-158196575 GAGAAAGTTTTAAGTAAAGATGG - Intronic
941170349 2:162128413-162128435 TACTAATTGTTCAGTAAAAAGGG - Intergenic
941369074 2:164641915-164641937 TAGAAAGAGTACAGGAAAGATGG - Intergenic
941776071 2:169395194-169395216 TAGTAAGTGCTCAATTAATAGGG - Intergenic
942297264 2:174529746-174529768 TGCTAAGTGTTTAGTTAAGATGG - Intergenic
942528761 2:176885725-176885747 TAGTAGGTGCTCAATAAAGCTGG - Intergenic
942810539 2:179994942-179994964 TTGTAATTTTTCAGTAGAGACGG - Intronic
943514758 2:188870427-188870449 CAGGAAGTGCTCAGTAAAGGGGG + Intergenic
944715431 2:202372687-202372709 TAATAAGTGCTTAGTTAAGATGG - Intergenic
944853831 2:203747203-203747225 TTGTATGTTTTCAGTAGAGATGG + Intergenic
945538918 2:211058017-211058039 TGGGAAGTCTTCAGGAAAGAGGG + Intergenic
945702017 2:213183440-213183462 AAGTAAATGTTGAGTATAGAGGG + Intergenic
945925453 2:215798699-215798721 TAATATGTGCTCAGTTAAGATGG - Intergenic
1169688200 20:8300780-8300802 TGTTAAGTGTTCAGTAAATGTGG + Intronic
1170386708 20:15826346-15826368 TAGTATGTTTTCAGTAAATGTGG - Intronic
1170795457 20:19543043-19543065 CAGTAAGTGCTCAGTACACATGG + Intronic
1173050106 20:39551021-39551043 TAGTAAGTGCTCAATAAATGCGG - Intergenic
1173195075 20:40907545-40907567 TAAGAAGTGTTCAGCATAGATGG - Intergenic
1173366761 20:42392911-42392933 AAGGAAGTCTTCAGAAAAGAAGG + Intronic
1173902889 20:46604038-46604060 TAGCAAATGTTCAGTAAATATGG + Intronic
1174933989 20:54847314-54847336 CAGTCATTGTTCAGCAAAGAAGG + Intergenic
1179114729 21:38479740-38479762 TAGTAAGTGCTTAGTTAAGATGG - Intronic
1180464745 22:15601182-15601204 TTGTAAATTTTTAGTAAAGACGG - Intergenic
1180685496 22:17663260-17663282 TAGTAAGAATTCAGAAATGATGG + Intronic
1182780716 22:32865254-32865276 TAGTAAGTGCTCATTAAATATGG - Intronic
1182793252 22:32970947-32970969 TAGTAAGAATGCAGTGAAGATGG - Intronic
1183795038 22:40110375-40110397 TAGTAAGCATTCAGTAAAGCTGG + Intronic
949972689 3:9424105-9424127 TGAGAAGTGTTCAGTGAAGAAGG + Intronic
951947489 3:28156759-28156781 TTGTTATTTTTCAGTAAAGACGG + Intergenic
952172959 3:30829741-30829763 TAGCAAGTATTCACTAAAAAGGG - Intronic
952947609 3:38489855-38489877 AAGTAATTGTTCAGAAAAGTGGG + Exonic
953377548 3:42441336-42441358 TAGCAAGTGCTCAGTAAGTATGG - Intergenic
954965501 3:54606815-54606837 TAGTCAGAGTTGAGCAAAGAGGG - Intronic
955222080 3:57031401-57031423 TAGTCAGTACCCAGTAAAGACGG - Intronic
955338460 3:58106506-58106528 CATTAAGTCTTCAGTAGAGATGG - Intronic
955493333 3:59505233-59505255 TAGTAAGGTTTCAGTCATGAAGG - Intergenic
956200172 3:66697474-66697496 TAGAAAGTGACCAGGAAAGAAGG - Intergenic
956774107 3:72550666-72550688 TAGTAAGTGTGCACCAAATAAGG + Intergenic
956916646 3:73878967-73878989 TAGAGAATGTTCAGTAAATAGGG - Intergenic
957800638 3:85075390-85075412 TAGGAAGTCTTCATTTAAGAGGG + Intronic
958190922 3:90183781-90183803 TGGTGAGTGTTCAATAAAAAAGG - Intergenic
958413125 3:93842916-93842938 TGGTGAGTGTTCAATAAAAAAGG - Intergenic
960078679 3:113516724-113516746 TAGTAAGTGTAAAGTAGGGATGG - Intergenic
960211881 3:114978476-114978498 TATTAAGTGTTCATTAGACATGG + Intronic
960509541 3:118531827-118531849 TTGTGGGTGTTCAGTCAAGATGG + Intergenic
961203199 3:125060653-125060675 TATAAAGTGTTAAGTAGAGAAGG + Intergenic
962313902 3:134346114-134346136 GACTAAGTGTTCAGTAAATGGGG - Intergenic
962936806 3:140089084-140089106 TAGCAGGTCTTCAGGAAAGAGGG - Intronic
962979312 3:140473476-140473498 TAGTAAGTGTTCTTATAAGAGGG + Intronic
964005777 3:151826713-151826735 TAATCAGTGGTCTGTAAAGAGGG - Intronic
964187734 3:153966794-153966816 TAGAAGGTGCTCAGTATAGATGG - Intergenic
964193223 3:154030819-154030841 TAGGAAGAGTTCATAAAAGATGG + Intergenic
964691993 3:159460476-159460498 AAGTAGGTGTTCTGTAGAGAAGG + Intronic
966429361 3:179815178-179815200 TAGTATGTGTTCAATAAATGTGG + Intronic
966731565 3:183155787-183155809 TAGACAGTGTTCAGTAAATATGG + Intronic
970783586 4:19768728-19768750 TAATAAGTGCTTAGTTAAGATGG - Intergenic
970911686 4:21284352-21284374 AAGTAAGTGTTCAGTAAAGGCGG - Intronic
971446801 4:26759044-26759066 AAGTAAGAGTTAGGTAAAGAGGG - Intergenic
973100205 4:46258189-46258211 TATTAGGTGCTCAGTAAATATGG - Intronic
973662057 4:53118261-53118283 TAGTAGGTGCTCAGTAAATAAGG + Intronic
973737335 4:53885531-53885553 TAGTAATGGTTCAATAAACAAGG + Intronic
975338917 4:73215036-73215058 TAGTATGTCTTAAGAAAAGATGG - Intronic
975644488 4:76532599-76532621 TGATAAGTGTTGAGTTAAGATGG - Intronic
975691731 4:76971954-76971976 AAGTAATTGTTAACTAAAGATGG + Intronic
977683514 4:99821186-99821208 TAGTAGGTGGTCAGTAAATTAGG - Intronic
978532847 4:109731493-109731515 TAGTAAGCACTCAATAAAGAGGG - Intergenic
978592614 4:110342418-110342440 GTGTACGTGTTTAGTAAAGAGGG + Intergenic
979338795 4:119495109-119495131 TAGTAAGTTTCAGGTAAAGAAGG + Exonic
979451212 4:120872949-120872971 TGGTAAGTGGACAGTTAAGATGG + Intronic
979939062 4:126737269-126737291 TAAAAAGTGTCCAGTAGAGAAGG + Intergenic
980501515 4:133660999-133661021 TGGAAAGTGATGAGTAAAGAAGG + Intergenic
980848242 4:138349986-138350008 CAGTAAGTGTTCTGCAAATAGGG - Intergenic
982116580 4:152103496-152103518 TAGTAAATGTTTAATGAAGACGG + Intergenic
982143515 4:152355420-152355442 TAGTAAGTTCACAGGAAAGAAGG + Intronic
983001537 4:162420213-162420235 TGCTAAGTGTTCAGTAAATGAGG - Intergenic
983363168 4:166753540-166753562 TAGTAATAGTTCAGTAATTAGGG - Intronic
983967049 4:173824926-173824948 TATTAAGAGTTCATTAAAAATGG - Intergenic
987245713 5:16046730-16046752 TAGGAAGTGTTCAGCAGAGATGG - Intergenic
989817128 5:45750290-45750312 TTGTATTTTTTCAGTAAAGATGG - Intergenic
990141332 5:52707661-52707683 TAGGAGCTGCTCAGTAAAGAGGG - Intergenic
990533588 5:56698008-56698030 TAGTTAGTGCTAAGTAAACATGG + Intergenic
991241042 5:64459966-64459988 TAGTAAAAGTTCAATAAATATGG - Intergenic
991282093 5:64926481-64926503 TAGTAAGCATTCAATAAATATGG - Intronic
991609387 5:68434907-68434929 TAATAAGTGTTCTGTAGACAGGG - Intergenic
992727538 5:79624321-79624343 TAGTAAGTGTACAGAAATGTTGG + Intronic
993224353 5:85147458-85147480 GAGTAAGTATTCAGTTAACATGG + Intergenic
993333918 5:86633642-86633664 TAGTAAGTATTGAGAAAAAAGGG - Intergenic
995695424 5:114873687-114873709 TAGTAAGAGCTCAATAAACATGG + Intergenic
995718594 5:115105527-115105549 TGGTAAGTGTTCTGTTAATATGG - Intergenic
996247331 5:121280862-121280884 TAGTAAATGCTCTATAAAGAGGG + Intergenic
996366115 5:122703171-122703193 TAATAAGTGTTCAATAAATGTGG + Intergenic
998813321 5:145987835-145987857 TAATAAGTGCTCAATAAATAAGG - Intronic
1000313559 5:160067828-160067850 AAGTAAGTGTTAAGGAAGGAAGG + Intronic
1000347072 5:160323060-160323082 TTGTATGTTTTTAGTAAAGACGG - Intronic
1000687990 5:164276595-164276617 TAGAAAGTGAACAGTAAAGGAGG + Intergenic
1001747794 5:174105177-174105199 TAGAGAGTGTTTAGTTAAGAAGG + Intronic
1002964355 6:1947839-1947861 TAGTAAGTGATAAGTAAAGTAGG - Intronic
1005604062 6:27457634-27457656 TAATAAGTGCTCAGTCAATATGG + Intronic
1005967551 6:30737933-30737955 TGCTAGGTGTTCAGGAAAGAAGG - Intronic
1006196971 6:32249917-32249939 GAGTAAAAGTTCAGTTAAGATGG - Intergenic
1006391816 6:33763089-33763111 TAGTGGGTCTTCAGTGAAGAGGG + Intergenic
1007049582 6:38813435-38813457 GTGTAAGTTTTCAGTAATGACGG + Intronic
1007477631 6:42129511-42129533 TAGTAAGTGCTCAGCAAACATGG + Intronic
1007863012 6:44934342-44934364 TACTAAATGTTCATTAATGAGGG + Intronic
1008101851 6:47400300-47400322 GAGTAAGTAGTCAGTAAATACGG + Intergenic
1008149743 6:47936398-47936420 TACAAAGTGTTTAATAAAGAAGG - Intronic
1008559410 6:52709097-52709119 TAGTGTGTCTTCAGTAAAAATGG + Intergenic
1010009112 6:71029205-71029227 TAGTAAATGTTGAATAAAAATGG + Intergenic
1010070982 6:71745193-71745215 TAGTAGGTGCTCAATAAACATGG - Intergenic
1010288582 6:74108879-74108901 GAGTAAGTGCTCAGTAAATATGG - Intergenic
1010429381 6:75761513-75761535 TAGTAAGTCATTAGTAAAAATGG + Intronic
1010800690 6:80171654-80171676 TAGTAGGTGCTTAGTAAATATGG + Intronic
1010819055 6:80391946-80391968 CAGAAAGTGATCAATAAAGAGGG - Intergenic
1010873214 6:81067548-81067570 TACTAAGTGTTCAATAACAATGG - Intergenic
1012021671 6:93929158-93929180 TGTTAAATGTTCACTAAAGAAGG - Intergenic
1012489799 6:99769720-99769742 AAGTAAGATTTCAGTAAAAAAGG - Intergenic
1012574988 6:100783833-100783855 TAGTACGTGCTCAGTAAAAATGG - Intronic
1013724472 6:113076755-113076777 TAGAAAGTGTTAAGTCAACAAGG + Intergenic
1014167316 6:118239897-118239919 TAATAAGTGATCAGAACAGAAGG + Intronic
1014353636 6:120376031-120376053 TCTTTAATGTTCAGTAAAGAAGG - Intergenic
1015649470 6:135439707-135439729 TGGTAAGTGTTTTGTTAAGATGG + Intronic
1017574303 6:155785091-155785113 TAATTTGTGTTGAGTAAAGATGG - Intergenic
1018127960 6:160700221-160700243 CAGTAAGTGGTCAATAAATAAGG + Intergenic
1018148474 6:160916173-160916195 CAGTAAGTGGTCAATAAATAAGG - Intergenic
1018552992 6:165020123-165020145 TATAAAGTTTTCAGTAAAGATGG - Intergenic
1021218363 7:17944262-17944284 TATTTAATGTTCAGTAGAGATGG - Intergenic
1022419009 7:30202852-30202874 AAGCAAGTGTCCAGTAAGGAAGG - Intergenic
1023093671 7:36639469-36639491 TAGTAGGTGCTCAGTAAACATGG + Intronic
1023949609 7:44832579-44832601 TTGCAAGTCTTCATTAAAGAAGG - Intronic
1024993033 7:55251212-55251234 TTGTAGGTGTTCAGTGTAGAGGG - Intronic
1027357589 7:77373414-77373436 TAGTAAATGTCCATTAAAGTTGG + Intronic
1027483024 7:78723315-78723337 TAGTAAGTGCTAAATAAATATGG - Intronic
1027540748 7:79461793-79461815 TACTAAGAGTTCAGTAGATAAGG - Intergenic
1028360362 7:89960230-89960252 TAGAAAATGTACAGTAAAAATGG - Intergenic
1028559198 7:92154941-92154963 TGATAAGTGCTCAGTTAAGAAGG - Intronic
1030066220 7:105661265-105661287 CATTAAATGTTGAGTAAAGATGG + Intronic
1030102431 7:105958047-105958069 TAGTAAGTGCTCAAAAAACATGG - Intronic
1030447693 7:109667877-109667899 AAGTAAGTGCTAAGTTAAGATGG - Intergenic
1030532852 7:110731843-110731865 TAGTAGGTGCTCAGTAAGTATGG - Intronic
1031082895 7:117275529-117275551 TAGTAAGATTTTAATAAAGAGGG + Intergenic
1031629035 7:124023852-124023874 TACTAAGTGTTGAGAAAACAGGG + Intergenic
1031771509 7:125850200-125850222 TGGTAAGTGCTTAGTTAAGATGG - Intergenic
1032503279 7:132416123-132416145 TAGTGAATTTTCAGTAAAAATGG - Intronic
1032655676 7:133926966-133926988 TATTAAATGTTCAGTGAAAAAGG + Intronic
1032865795 7:135922981-135923003 TAGTAAATGTTCAGTTAAAATGG + Intergenic
1032995122 7:137436332-137436354 TAGAAAGTGATTATTAAAGATGG - Intronic
1033051997 7:138014029-138014051 AAGTAAAAGTTCAGTTAAGATGG + Intronic
1033759792 7:144426244-144426266 TAGTAAGTTTTCAGGAAGAATGG - Intergenic
1034828517 7:154288715-154288737 TAGTAGGTGCTCAATAAATATGG - Intronic
1037223154 8:16550966-16550988 TAGCAAGTGTCTTGTAAAGAGGG + Intronic
1038119432 8:24595847-24595869 TAGTAAATATGCAGTAAAGCAGG - Intergenic
1038338979 8:26668403-26668425 TACCACGTGTACAGTAAAGAGGG + Intergenic
1038469888 8:27806169-27806191 TGATAAGTGCTCAGTTAAGATGG + Intronic
1038969628 8:32618641-32618663 TGGTAAGTTCTCAGTAAATATGG + Intronic
1039165283 8:34672500-34672522 TATTAAGTGCTTAGTTAAGATGG + Intergenic
1039197513 8:35048867-35048889 TAGTAAATGTTAAGAAAACAGGG + Intergenic
1042745706 8:72103419-72103441 TTGTAAGTGTTCAGGAAAATGGG - Intronic
1043608805 8:82035950-82035972 TAGTAAGAGCTCAATAAATATGG - Intergenic
1044077266 8:87837694-87837716 TAGTGAGTGCTCAGGAAAAAAGG + Intergenic
1044802787 8:95974492-95974514 TAGTGAGTGATCAGTAAGGTTGG - Intergenic
1046002821 8:108442654-108442676 AAGTTATTGGTCAGTAAAGAAGG - Intergenic
1046720010 8:117608531-117608553 TAATAGGTGTTCAGTAAATGTGG - Intergenic
1046801520 8:118433591-118433613 TAGTAAGTGTTCCATTAAAAGGG + Intronic
1047320788 8:123780074-123780096 TAGTAAGTGGTTAGTAGAAATGG + Exonic
1047774757 8:128060602-128060624 TAATTGGTGTTCAGGAAAGAAGG - Intergenic
1050498675 9:6271174-6271196 TAGGAAGTGTTCAGAACAGCTGG + Intergenic
1050667878 9:7961836-7961858 CAGTAAATGATCAGTAAACATGG + Intergenic
1051210675 9:14739058-14739080 TATTAAGACTTCAGAAAAGAGGG + Intronic
1052038540 9:23711055-23711077 TATTAAGTTTTCAATAAGGAAGG + Intronic
1052659291 9:31407382-31407404 TAGTAAGTGCTTAATTAAGATGG - Intergenic
1052693544 9:31848505-31848527 TAATAAGTGTTTAGTTAAGATGG + Intergenic
1055275655 9:74612486-74612508 TAGCGTGTGTTCAGGAAAGAAGG - Intronic
1056505490 9:87254300-87254322 TAGTAAACGTTCAGTAAACAGGG - Intergenic
1056945455 9:90991780-90991802 TCATAAGTCTTCAGTAAAGGGGG + Intergenic
1056953924 9:91067458-91067480 TTGGGAGTGTTCAGGAAAGAAGG + Intergenic
1057616399 9:96594544-96594566 TTTTATGTTTTCAGTAAAGAGGG - Intronic
1058707175 9:107647119-107647141 CTGTACATGTTCAGTAAAGATGG - Intergenic
1059148351 9:111922509-111922531 TAGTAAATCTTCAGTAGTGATGG + Intronic
1059699084 9:116757763-116757785 TAGAAGGTGTCCAGTAAAGATGG + Intronic
1060259226 9:122059295-122059317 TAGTAAATGCTCAGCAAACATGG - Intronic
1061200278 9:129134185-129134207 TAGTAGGTGCTCAGTAAATATGG + Intronic
1061213572 9:129207417-129207439 GAGCAGGTGTTCAGTAAATATGG - Intergenic
1061279030 9:129586566-129586588 TAGTAGGTGCTCAGGAAGGAAGG + Intergenic
1061404041 9:130383826-130383848 CAGTAAGTGCTCAGTAATGGTGG - Intronic
1061711251 9:132489539-132489561 TAGTAGGCGCTCAATAAAGAGGG + Intronic
1186674998 X:11806912-11806934 TAGTGAGTGTTTAATAAATATGG + Intergenic
1188344648 X:29048960-29048982 TAGTATTTGTTCAGTAAGTATGG + Intronic
1192245064 X:69365232-69365254 TAGTATGTGCTCAATAAATATGG + Intergenic
1193734446 X:85140296-85140318 TAGTAAGTGCTCAGTAAGTGTGG - Intergenic
1195478655 X:105317687-105317709 GAGTCTTTGTTCAGTAAAGAAGG - Intronic
1195613886 X:106897542-106897564 CAGCAAGTGTGCAGTAAGGAGGG + Intronic
1195746282 X:108121816-108121838 TACTATGTGTTAAGTATAGAGGG - Intronic
1196282075 X:113833516-113833538 TAGTAATTTTGCTGTAAAGATGG + Intergenic
1198449622 X:136754199-136754221 TATTAAGTGTTCAGGTAAGAGGG + Intronic
1198842758 X:140876593-140876615 TTCCACGTGTTCAGTAAAGATGG - Intergenic
1199425759 X:147699002-147699024 GCATAAGGGTTCAGTAAAGATGG + Intergenic
1200749778 Y:6934249-6934271 TAATAAGTATTAAGTAGAGAAGG - Intronic