ID: 1093205667

View in Genome Browser
Species Human (GRCh38)
Location 12:16245987-16246009
Sequence CTTTGATTAATTGAGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 223}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093205663_1093205667 -9 Left 1093205663 12:16245973-16245995 CCCATTATGTCAGCCTTTGATTA 0: 1
1: 0
2: 0
3: 14
4: 191
Right 1093205667 12:16245987-16246009 CTTTGATTAATTGAGGAAGCTGG 0: 1
1: 0
2: 1
3: 16
4: 223
1093205664_1093205667 -10 Left 1093205664 12:16245974-16245996 CCATTATGTCAGCCTTTGATTAA 0: 1
1: 0
2: 0
3: 16
4: 197
Right 1093205667 12:16245987-16246009 CTTTGATTAATTGAGGAAGCTGG 0: 1
1: 0
2: 1
3: 16
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093205667 Original CRISPR CTTTGATTAATTGAGGAAGC TGG Intronic
903797871 1:25943854-25943876 TTGTGATTGATTGAGCAAGCAGG - Intergenic
907546572 1:55265228-55265250 TTGTGAATAACTGAGGAAGCTGG + Intergenic
908153893 1:61332976-61332998 CTTTGATCAATGGAGCAAGATGG - Intronic
909812696 1:79951194-79951216 ATTTGATTAATCGAGAAAACTGG + Intergenic
911758483 1:101588701-101588723 CTTTGAATAATTATGCAAGCTGG - Intergenic
915227972 1:154424964-154424986 TTGTGATTGATTGAGCAAGCAGG + Intronic
916634431 1:166653168-166653190 TTGTGATCAATTGAGCAAGCAGG + Intergenic
917629857 1:176880852-176880874 CATTTTTTAATTGAGGAAACAGG - Intronic
919316999 1:195983660-195983682 CTGTTATTAATAGAGTAAGCAGG + Intergenic
919532935 1:198747305-198747327 CTTCCAAGAATTGAGGAAGCTGG + Intronic
919949498 1:202349289-202349311 ACTTGATTAGTGGAGGAAGCTGG - Intronic
921117264 1:212105033-212105055 CTTGGATTACTTGATAAAGCAGG + Intronic
921711759 1:218379798-218379820 TTTTAGTTAATGGAGGAAGCTGG + Intronic
922680303 1:227589626-227589648 CTGTGATCAATTGAGCAAGCAGG + Intronic
922864759 1:228850456-228850478 CTGTGATCAATTGAGCAAGCAGG + Intergenic
922870823 1:228900517-228900539 CTTTTATCACTTCAGGAAGCTGG - Intergenic
1064346515 10:14537432-14537454 CTTAGAGCAAGTGAGGAAGCTGG - Intronic
1064506863 10:16040769-16040791 CTCTGATTAAAAGAGAAAGCAGG + Intergenic
1064927916 10:20590454-20590476 CTTTGAGTAGATGAGGAAGTGGG - Intergenic
1065409685 10:25410994-25411016 CTTTGATTAACTGAGGAATTTGG - Intronic
1065704313 10:28457894-28457916 TTGTGATCAATTGAGCAAGCAGG + Intergenic
1066258503 10:33705326-33705348 CTTGGATGAATGGATGAAGCTGG - Intergenic
1069060295 10:63887792-63887814 AGTTGATTAATTCAGGGAGCCGG + Intergenic
1071355214 10:84786667-84786689 CTTTGGTCAGTTGAGGAAACAGG - Intergenic
1073903613 10:108251167-108251189 CTCTGACTAATTGAGGCATCCGG + Intergenic
1074369051 10:112884328-112884350 CTTTGATCACTTGATGAAGGTGG + Intergenic
1075925813 10:126251350-126251372 CTTTATTTAGATGAGGAAGCAGG + Intronic
1078106098 11:8358903-8358925 CTTTGATCACGTGAGGAAGGTGG - Intergenic
1078776412 11:14397851-14397873 CTTTGATAATTTGATGAAGGTGG - Intergenic
1079907640 11:26269005-26269027 CATTGAGTTATTGAGGAATCTGG + Intergenic
1080523298 11:33087526-33087548 GTTTCATTAAATGAAGAAGCTGG + Intronic
1082621007 11:55422283-55422305 TCTTGATTAATTGAGCAAGCAGG + Intergenic
1083089531 11:60185710-60185732 TCTTGATCAATTGAGCAAGCAGG - Intergenic
1086413941 11:86570229-86570251 GGTTGATTGATGGAGGAAGCCGG - Intronic
1086836385 11:91629057-91629079 TTTTAATTAATTGAGAAAGTAGG + Intergenic
1086972992 11:93103697-93103719 TTGTGATTGATTGAGCAAGCAGG + Intergenic
1091266101 11:134272130-134272152 CTTTGAGAGATTGAGGAGGCAGG + Intergenic
1092113373 12:5980491-5980513 CTTTGATTTGTTGGGGAAGCTGG - Intronic
1093205667 12:16245987-16246009 CTTTGATTAATTGAGGAAGCTGG + Intronic
1096455906 12:51786213-51786235 ATTTTATGAATTGAGGAAGAGGG + Intronic
1096634127 12:52947985-52948007 ATTTGTTTAATTAAGGATGCAGG + Intronic
1098206426 12:68115312-68115334 TTTTGATGATTTGAGGGAGCTGG + Intergenic
1098248037 12:68540495-68540517 TTGTGATTGATTGAGCAAGCAGG - Intergenic
1098749118 12:74272826-74272848 TTGTGATCAATTGAGCAAGCAGG - Intergenic
1098899655 12:76099812-76099834 CTTTGTTTAAAGGGGGAAGCTGG + Intergenic
1099688907 12:85925645-85925667 TTGTGATCAATTGAGCAAGCAGG - Intergenic
1100434847 12:94561952-94561974 ATTTGATTAAATGAGGATGAGGG - Intergenic
1102608667 12:114091322-114091344 CTTTGATTAGGTGAGGCAGCAGG + Intergenic
1103296236 12:119889520-119889542 CTGTGATCGATTGAGCAAGCAGG + Intergenic
1107185401 13:37513042-37513064 ATATTATTAATTGTGGAAGCAGG - Intergenic
1108029004 13:46208602-46208624 GTTATATTAATTGAGGATGCTGG - Intronic
1108201836 13:48051791-48051813 CTTTGATTATTTGAGGATTTAGG + Intergenic
1108847623 13:54696050-54696072 CATTGATAACTTGAGGATGCAGG - Intergenic
1108934237 13:55866456-55866478 CATTGATAACTTGAGGATGCAGG - Intergenic
1109460368 13:62648376-62648398 CTTTTATAAAATAAGGAAGCTGG - Intergenic
1110133076 13:72031072-72031094 CTTTGTGAAGTTGAGGAAGCAGG + Intergenic
1111414507 13:87921912-87921934 AATTGATTATTTGATGAAGCTGG + Intergenic
1114388364 14:22279258-22279280 ATTTGATTAACTGTGGAAGTTGG + Intergenic
1114431911 14:22669096-22669118 GTTTGATTAACTGAGGAAAGGGG - Intergenic
1115096884 14:29648417-29648439 TTTTGATTAATAGAGGCAGGAGG + Intronic
1115121184 14:29940318-29940340 GTTTTATAAAATGAGGAAGCAGG - Intronic
1116095973 14:40368302-40368324 TATTGATTAATTGAGGTAGTTGG + Intergenic
1116176241 14:41473735-41473757 TTTTGATTATTCGAGGATGCAGG - Intergenic
1116876064 14:50113386-50113408 CTTTGGTTTAATGAGAAAGCAGG - Intronic
1120593869 14:86409591-86409613 TATTTATTAAATGAGGAAGCGGG + Intergenic
1120831144 14:88998779-88998801 CTAAGGTTAATAGAGGAAGCAGG - Intergenic
1120857010 14:89221606-89221628 CTTTGATCCAGTGAGGAAGTTGG - Intronic
1121227590 14:92332931-92332953 CTTTGAAGAATTTAGGATGCTGG + Intronic
1121569280 14:94935312-94935334 CCTTGATTTTTTGAGCAAGCTGG + Intergenic
1121591611 14:95117737-95117759 CTTAGATTGATAAAGGAAGCTGG - Exonic
1122213875 14:100190963-100190985 CCTTGATTAATTAAGGTATCTGG - Intergenic
1122214068 14:100192223-100192245 CCTTGATTAATTAAGGTATCTGG - Intergenic
1123854691 15:24396508-24396530 CTTTCAGTGATTGAGGAAGATGG + Intergenic
1124360504 15:29033405-29033427 CTTTGGAGAGTTGAGGAAGCAGG - Intronic
1125208169 15:37178807-37178829 CTTTGAAAAATTAAGCAAGCTGG - Intergenic
1126380144 15:48038159-48038181 CTATAATGAATTGAGGAAGCAGG - Intergenic
1128203006 15:65825924-65825946 TTGTGATCAATTGAGCAAGCAGG - Intronic
1130509426 15:84576533-84576555 TCGTGATCAATTGAGGAAGCAGG + Intergenic
1133075224 16:3275000-3275022 CATTGATTAGTTGTGGAAGGTGG - Intronic
1133576629 16:7097566-7097588 ATTTGATTATTTGAGGCAGATGG - Intronic
1137373549 16:47931196-47931218 CTTTGATTACTTGATTAAGGTGG + Intergenic
1139011992 16:62645681-62645703 CATTGATAACTTGAGGAGGCAGG + Intergenic
1140257783 16:73351537-73351559 CTTTAAATTATTTAGGAAGCTGG - Intergenic
1142963710 17:3567474-3567496 CTTTGAGTAGTTGAGGGAGGAGG - Intronic
1144414375 17:15032411-15032433 CTTTGATTAATCGATGGAGCTGG - Intergenic
1146141227 17:30369655-30369677 CTTTGCTTGTTTGATGAAGCAGG + Intergenic
1150505858 17:65698527-65698549 CTTTGATGATCTAAGGAAGCCGG + Intronic
1150837540 17:68578167-68578189 CTTTGATTATTAGAGGACCCAGG - Intronic
1153357869 18:4157812-4157834 CTGTGAGTAAGTGGGGAAGCTGG + Intronic
1154230562 18:12552712-12552734 TTGTGATTGATTGAGCAAGCAGG - Intronic
1156289709 18:35735607-35735629 TTGTGATCAATTGAGCAAGCAGG - Intergenic
1156674397 18:39510287-39510309 GTTGGATTAATTGAGGAATGTGG + Intergenic
1158292566 18:55957785-55957807 TTGTGATTGATTGAGCAAGCAGG - Intergenic
1158695330 18:59697942-59697964 CTTAGATTATGTGAGGAAGGAGG + Intergenic
1159222907 18:65488531-65488553 CGTTGATCATTAGAGGAAGCAGG + Intergenic
1160074716 18:75663126-75663148 TTGTGATTGATTGAGCAAGCAGG + Intergenic
1162803978 19:13127123-13127145 CTATGATTTATTTAGCAAGCTGG - Intronic
1163942751 19:20510110-20510132 CTGTGATCAATTGAGCAAGCAGG + Intergenic
1163991456 19:21002649-21002671 TTGTGATCAATTGAGAAAGCAGG - Intergenic
1166275590 19:41751346-41751368 CTTTCAGTAAATGAGGAAACTGG - Intronic
1166280658 19:41790673-41790695 CTTTTAGTAAATGAGGAAACTGG - Intergenic
925617871 2:5761165-5761187 CTTTGTTTAATTAGGGAAACAGG - Intergenic
927195559 2:20544050-20544072 TTTTGATTTATCGGGGAAGCCGG + Intergenic
927203798 2:20594404-20594426 CTTTGGTGCATTGAGGCAGCTGG + Intronic
927554199 2:24021197-24021219 CTCAGATTAATGGAGGAAGCAGG - Intronic
928692828 2:33818728-33818750 CTTTAATTAACTGAGGAAGGTGG + Intergenic
929581589 2:43084930-43084952 CTTTGATGACTTGAAGAAGGAGG - Intergenic
932490683 2:72118117-72118139 CTTTGCTTAATAGAGGGAACAGG + Intergenic
933647751 2:84826163-84826185 CTTTGATTTAGTGAGGAACATGG + Intronic
934565284 2:95336289-95336311 CTTTGTATAGTTGTGGAAGCTGG - Intronic
934961833 2:98682621-98682643 CTTTGATCACTTGATGAAGGTGG - Intronic
935311622 2:101789332-101789354 CTATCATTAATTTAGGAAACAGG + Intronic
938127195 2:128683070-128683092 TCTTGATCAATTGAGCAAGCAGG - Intergenic
940237299 2:151525293-151525315 CTTTTATGAGTAGAGGAAGCTGG + Intronic
940558650 2:155265097-155265119 CATTTTGTAATTGAGGAAGCTGG - Intergenic
942568271 2:177288230-177288252 CTTTGTTAAATTGAGGAACGAGG - Intronic
942747568 2:179252655-179252677 CTTGGTTAAATTGAGGAAGTAGG + Intronic
943914214 2:193607405-193607427 TTTTGAATAATTAAGGAATCTGG + Intergenic
943993403 2:194728187-194728209 GTTTGATGAATTAAGAAAGCTGG + Intergenic
944337018 2:198546201-198546223 CTTTGTTTAAATGTGGAAGTTGG - Intronic
944373754 2:199015385-199015407 CCTTGATGAATTGGGGAGGCAGG - Intergenic
945821498 2:214671220-214671242 CTTTGATTACTGAAGGAAGGAGG - Intergenic
1170394051 20:15906901-15906923 CTTTGATTACTTGATTAAGGTGG + Intronic
1172590616 20:36115213-36115235 CTTTGAGTAAGTAAGGGAGCTGG + Intronic
1173229098 20:41180331-41180353 CTTTCAGAAATTGAGGAAGGGGG + Exonic
1173754245 20:45500987-45501009 CTTTGACTACTTGAGTAAGATGG + Intergenic
1174806712 20:53609872-53609894 CTTTGATTAAAGGAGGAAACTGG - Intronic
1175048682 20:56132414-56132436 CTGAGATTAATTGAGGAAGCGGG - Intergenic
1175635444 20:60578948-60578970 TTGTGATTGATTGAGCAAGCGGG - Intergenic
1181032169 22:20153887-20153909 CCTTGTTAACTTGAGGAAGCCGG + Intergenic
1181913398 22:26258582-26258604 CTGTGTTTAAATGAGGAAGTTGG + Intronic
1183880958 22:40828724-40828746 TTTTAATTAACTGTGGAAGCAGG - Intronic
955438695 3:58931930-58931952 CTTTGACGAGTTGAGGAAGAAGG + Intronic
956557547 3:70539932-70539954 CATTGATAACTTGAGGATGCAGG - Intergenic
960334102 3:116394734-116394756 GTTCAATAAATTGAGGAAGCAGG - Intronic
961079459 3:124013573-124013595 GTTTGATTATTTCAGGAAGTTGG - Intergenic
961326025 3:126109897-126109919 CTTGGGTCAATTGAGGCAGCAGG - Intronic
963315358 3:143752976-143752998 CTTTGATTTATTGAGTAAGTAGG + Intronic
963357384 3:144226348-144226370 GTTTGAATAAGGGAGGAAGCAGG + Intergenic
963982520 3:151555589-151555611 CTTTGATTAGGTCAGGCAGCTGG - Intergenic
964078017 3:152715486-152715508 CTTTGATCACTTGATGAAGGTGG + Intergenic
964307177 3:155354577-155354599 TTTTGATTAAATGATGAAGAGGG + Intergenic
964932535 3:162044695-162044717 TTGTGATTGATTGAGCAAGCAGG + Intergenic
966495054 3:180570667-180570689 CTTTGAGGAACTGAGGAAGGAGG + Intergenic
967663771 3:192147049-192147071 ATTTGATTTATTGAGGAGGGGGG - Intronic
968221535 3:196943423-196943445 CTTTGATTAAATGTGTGAGCTGG + Intergenic
970528523 4:16957707-16957729 CTGTGCTTAATTGAGGAGGGTGG + Intergenic
971211411 4:24621438-24621460 TTGTGATTGATTGAGCAAGCAGG + Intergenic
973235479 4:47898432-47898454 ATTGGATTAATTCAAGAAGCAGG + Intronic
973861069 4:55065386-55065408 CTTTTATTAAATGACTAAGCAGG - Intergenic
974129917 4:57741859-57741881 CTTTGTTTAATTAATGAAACAGG + Intergenic
975179221 4:71324197-71324219 CTTGGATTAAGTGAGGAAAATGG + Intronic
976077151 4:81312617-81312639 GTTTGATTAATTTGGGAAGGGGG - Intergenic
976676233 4:87706815-87706837 CTTTTTTTAAGTGAGGAAGAGGG - Intergenic
976677433 4:87718834-87718856 CTTTGATTACTTGATTAAGGTGG - Intergenic
977541734 4:98326250-98326272 TTTTGATTTATTGGGGAAGATGG - Intronic
977605713 4:98983383-98983405 CTTTGATTACTTGATTAAGGTGG + Intergenic
979136446 4:117117269-117117291 CATTGATAACTTGAGGATGCAGG - Intergenic
979924680 4:126546464-126546486 TTGTGATCAATTGAGCAAGCAGG - Intergenic
980117245 4:128691291-128691313 TTGTGATCAATTGAGCAAGCAGG - Intergenic
982568882 4:157023311-157023333 TTTTGTTAAATTGAGGAAGAGGG + Intergenic
982938069 4:161511119-161511141 CTTTGAATTATTAAAGAAGCAGG - Intronic
984476358 4:180240008-180240030 TTTTGATTAATTAAGGATGTAGG + Intergenic
985848096 5:2368759-2368781 CTCTGATGACTTGAGGAACCAGG + Intergenic
986521052 5:8618773-8618795 CTGTGATTAATTGAGCACGATGG - Intergenic
987172302 5:15271396-15271418 CTTTCATAAATTTAGGAAGATGG + Intergenic
989110011 5:37898104-37898126 CTTTGATTACTTGATTAAGCTGG + Intergenic
990861600 5:60333683-60333705 ATGTGGTGAATTGAGGAAGCTGG - Intronic
992346248 5:75881241-75881263 CTCAGATTAATTGAGGAATTAGG - Intergenic
992942257 5:81774012-81774034 CTTTGATGAAATGATGAAGCTGG + Intergenic
993190949 5:84679885-84679907 CTAGGATTAATAGATGAAGCCGG + Intergenic
994186711 5:96823117-96823139 CCTTGCTTCCTTGAGGAAGCAGG - Intronic
995229066 5:109737957-109737979 CCTTGATGAACTGAGGGAGCTGG + Intronic
995887723 5:116915126-116915148 CTTTCATTAAATGATAAAGCTGG + Intergenic
998467625 5:142358088-142358110 CTTTAAACAGTTGAGGAAGCAGG + Intergenic
1000649810 5:163803437-163803459 ATTTGACTAATTTAGGCAGCAGG + Intergenic
1005241675 6:23837452-23837474 TTGTGATTGATTGAGCAAGCAGG - Intergenic
1006770012 6:36545357-36545379 CTTTGACTAATTTAAGTAGCTGG + Intronic
1007647383 6:43393411-43393433 TTGTGATCAATTGAGTAAGCAGG - Intergenic
1008251911 6:49250624-49250646 CTTTTTTTAATTGAAGAAACAGG - Intergenic
1010185273 6:73136651-73136673 ATTGGATTAAATGAGGAGGCAGG - Intronic
1010511082 6:76721108-76721130 CATTTATTAATTGAGGTATCAGG + Intergenic
1011892233 6:92179050-92179072 CATTGCTTAGTTTAGGAAGCTGG - Intergenic
1011904738 6:92350862-92350884 CTGTGCTCACTTGAGGAAGCAGG - Intergenic
1016026199 6:139289333-139289355 TTGTGATTGATTGAGCAAGCAGG - Intronic
1016636193 6:146294626-146294648 CTGTTATTAATAGAAGAAGCTGG - Intronic
1017389152 6:153919992-153920014 CTTTTATTAATATAGGAACCTGG - Intergenic
1018560701 6:165098543-165098565 CATTGATAACTTGAGGACGCAGG + Intergenic
1020763217 7:12292236-12292258 CATTGATAACTTGAGGATGCAGG + Intergenic
1020781582 7:12522868-12522890 CTTTGAAAAATTTATGAAGCAGG - Intergenic
1020911594 7:14138572-14138594 CCTTGCTTACTTGAGGATGCTGG + Intergenic
1024665922 7:51547000-51547022 CTTATCTTAAATGAGGAAGCAGG - Intergenic
1024718998 7:52113545-52113567 TTGTGATCAATTGAGCAAGCAGG - Intergenic
1025710652 7:63905236-63905258 TTGTGATTGATTGAGCAAGCAGG + Intergenic
1025802884 7:64804341-64804363 CTGTGATCAATTGAGCAAGCAGG - Intronic
1027558732 7:79699731-79699753 CATTGATTAAAAGAGGAAACAGG - Intergenic
1027774548 7:82447764-82447786 GTTTGTTTAATGGAGGAAACGGG - Intergenic
1028166516 7:87543876-87543898 CATTGACTATTTCAGGAAGCTGG + Intronic
1030847408 7:114437324-114437346 CTTTGTTTTATTTAGGCAGCAGG + Intronic
1031916794 7:127570922-127570944 CTGTGATGGATTGAGCAAGCAGG - Intergenic
1035871141 8:3137278-3137300 ATTTAATTTAATGAGGAAGCCGG + Intronic
1036126620 8:6068787-6068809 CTTTGCTTACATGATGAAGCTGG + Intergenic
1039127072 8:34215389-34215411 CTTTGTTTAACTAAGCAAGCTGG - Intergenic
1039373544 8:37011025-37011047 AGTTGATTAATTGAGGAACTAGG + Intergenic
1040963183 8:53057156-53057178 ATTTAGTTAATTGAGGAAGTTGG + Intergenic
1041227579 8:55715855-55715877 TTGTGATTGATTGAGCAAGCAGG - Intronic
1043859106 8:85295024-85295046 CTTTCATTATTTGGGGAAGGAGG - Intergenic
1043913225 8:85888925-85888947 CTTTGTTTATTTGAGGAAAGGGG + Intergenic
1045578693 8:103454280-103454302 CTTTGATTCAGTAAGTAAGCTGG + Intergenic
1046438115 8:114221424-114221446 TTTGGAATAATTAAGGAAGCAGG + Intergenic
1046802263 8:118441559-118441581 CTTTTATTAATTGTGGTAGATGG + Intronic
1048053515 8:130842100-130842122 CTTTGATTCATTCAAGATGCTGG + Intronic
1050146541 9:2574182-2574204 ATTTGATGAACTGAGAAAGCAGG - Intergenic
1051093662 9:13439740-13439762 CTTTTATTAATTGAACTAGCAGG + Intergenic
1051454318 9:17236519-17236541 CCTGGAGAAATTGAGGAAGCAGG + Exonic
1051850445 9:21500651-21500673 CTTTGACTAACCTAGGAAGCTGG + Intergenic
1056410010 9:86316287-86316309 CATTGATAAATTGAGGCAACTGG - Intronic
1056703763 9:88934046-88934068 TCTTGATCAATTGAGCAAGCAGG + Intergenic
1056922940 9:90808239-90808261 CTATGATTATTTTAGCAAGCAGG + Intronic
1058565023 9:106274239-106274261 GTTTGATTATTTGATTAAGCTGG + Intergenic
1061203263 9:129149141-129149163 ATTTTGTGAATTGAGGAAGCTGG - Intergenic
1187196411 X:17089285-17089307 AGTTGATTAATTGTTGAAGCTGG - Intronic
1188336719 X:28944825-28944847 CTTTTTTTAATTGAGCAAGATGG - Intronic
1188620824 X:32221290-32221312 CTTTGATTAGGTGAGGAGGAGGG + Intronic
1189533632 X:41912934-41912956 CTTTTTATAAATGAGGAAGCAGG + Intronic
1189763013 X:44342323-44342345 CTTTGATAACTTTAGAAAGCAGG - Intronic
1189974567 X:46448260-46448282 CTGAGACTAAGTGAGGAAGCTGG - Exonic
1191638902 X:63409301-63409323 TTGTGATCAATTGAGCAAGCAGG - Intergenic
1192664618 X:73076219-73076241 CTTTGATCAATTTAAGAAGGTGG + Intergenic
1193079147 X:77388886-77388908 TTTTAGTTATTTGAGGAAGCTGG - Intergenic
1193553586 X:82928558-82928580 CATTGATAATTTGAGGATGCAGG + Intergenic
1193718027 X:84954462-84954484 TTGTGATTGATTGAGCAAGCAGG - Intergenic
1194594775 X:95843701-95843723 CTTTGAATAAATGTGTAAGCAGG + Intergenic
1196357907 X:114815626-114815648 TATTGATAAATTAAGGAAGCTGG + Intronic
1196534578 X:116827889-116827911 CTTTCATTAATGGAGAATGCAGG - Intergenic
1197029034 X:121791244-121791266 CTTTACAAAATTGAGGAAGCAGG - Intergenic
1198062248 X:133058347-133058369 CTTTAATTAATAGATCAAGCAGG - Intronic
1198132997 X:133717577-133717599 TTGTGATTGATTGAGCAAGCAGG - Intronic
1198556710 X:137801376-137801398 CAATGATTATTTCAGGAAGCAGG - Intergenic
1199084380 X:143611820-143611842 CGTTTATTAATTGAAGAATCAGG - Intergenic
1200533320 Y:4362182-4362204 TCTTGATCAATTGAGCAAGCAGG - Intergenic