ID: 1093213271

View in Genome Browser
Species Human (GRCh38)
Location 12:16332817-16332839
Sequence CTCTGTAAGCAGGACATGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093213271_1093213277 11 Left 1093213271 12:16332817-16332839 CCACCCATGTCCTGCTTACAGAG No data
Right 1093213277 12:16332851-16332873 CCATTTTACAGAGTGCTGATTGG 0: 956
1: 1775
2: 2230
3: 2018
4: 1779

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093213271 Original CRISPR CTCTGTAAGCAGGACATGGG TGG (reversed) Intergenic
No off target data available for this crispr