ID: 1093213538

View in Genome Browser
Species Human (GRCh38)
Location 12:16335668-16335690
Sequence CCTAAAGTACTGTTGGTAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093213532_1093213538 6 Left 1093213532 12:16335639-16335661 CCACTTGAGAGGATCTTGGGAGT No data
Right 1093213538 12:16335668-16335690 CCTAAAGTACTGTTGGTAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093213538 Original CRISPR CCTAAAGTACTGTTGGTAAA GGG Intergenic
No off target data available for this crispr