ID: 1093214176

View in Genome Browser
Species Human (GRCh38)
Location 12:16343835-16343857
Sequence GTATTTAGAAGCAGAATTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 552
Summary {0: 1, 1: 0, 2: 11, 3: 79, 4: 461}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093214173_1093214176 9 Left 1093214173 12:16343803-16343825 CCATATGCTTTCATTTCTCTTGG 0: 1
1: 17
2: 35
3: 119
4: 522
Right 1093214176 12:16343835-16343857 GTATTTAGAAGCAGAATTGTTGG 0: 1
1: 0
2: 11
3: 79
4: 461

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093214176 Original CRISPR GTATTTAGAAGCAGAATTGT TGG Intergenic
901181592 1:7345825-7345847 GTATTTAGGAGCAGAAAGGCAGG - Intronic
901546255 1:9959902-9959924 GTATTTAATGGCAGCATTGTTGG + Intronic
902064754 1:13675529-13675551 TTATCTAGAAGTAGAATTGCTGG + Intergenic
902177730 1:14663798-14663820 ATAACTAGAAGCAGAATTGCTGG - Intronic
902371640 1:16011140-16011162 ATATCTAGGAGCAGAATTGCTGG - Intergenic
902948380 1:19860740-19860762 GTGTTTAGAAGCACATCTGTAGG + Intergenic
903076454 1:20771359-20771381 GTATTTAGAAGATGAATCTTTGG + Intronic
904190583 1:28740242-28740264 GCATTTAGAAGCATAATTCTAGG + Intronic
905228728 1:36497656-36497678 TTCTTTAGAAGAAGAATTGCTGG + Intergenic
905621006 1:39447537-39447559 GTATTTAGAATCAGGCTTGGTGG - Exonic
905930558 1:41783947-41783969 GGATTTAGAATCAGACTTCTTGG + Intronic
906186743 1:43868001-43868023 ATATTAAGAAGTGGAATTGTTGG - Intronic
906578602 1:46914679-46914701 ATACTTAGTAGCAGTATTGTGGG + Intergenic
910089497 1:83445567-83445589 GGATCTAGAAGCAGATTTGGAGG - Intergenic
911385891 1:97175071-97175093 ATACCTAGAAGTAGAATTGTTGG + Intronic
912037076 1:105331507-105331529 GTATTTAAAAGTAGAATGGAAGG + Intergenic
912063216 1:105700414-105700436 GTATATAGAAGTAGAAATGAAGG - Intergenic
912800603 1:112717494-112717516 GTATGAAGAAGCAGACTTGTGGG + Intergenic
914328761 1:146646641-146646663 ATATTTATAAGTAGATTTGTTGG + Intergenic
917895529 1:179483866-179483888 ATATTTAGAAACAGAAAAGTTGG + Intronic
917910146 1:179635469-179635491 TTATTTAAATGCATAATTGTGGG + Intronic
919016828 1:192049205-192049227 GAATTTAGAAAAAGAAATGTAGG + Intergenic
919113820 1:193255584-193255606 GAAGTTAGAAGCTGTATTGTGGG + Intergenic
919227449 1:194724800-194724822 GGCTTTAGAAGCAGAATATTTGG + Intergenic
921372382 1:214437681-214437703 TTATTTAGTAGAAAAATTGTGGG - Intronic
921739445 1:218667166-218667188 GTTCTTAGAAGCAGAATTGTGGG - Intergenic
923368715 1:233289026-233289048 GTCTTCACAAGCAAAATTGTGGG - Intronic
923410431 1:233702933-233702955 GTATTTAGATGCAACATTCTGGG - Intergenic
1063555978 10:7080239-7080261 ATATTCAGAAGTGGAATTGTAGG + Intergenic
1063728926 10:8673052-8673074 GCGTTTAGAAGCAGATTTGTAGG + Intergenic
1064541191 10:16406684-16406706 GTTTATAGCAGCGGAATTGTTGG - Intergenic
1065167771 10:22998593-22998615 ATACTTAGAAACAGAATTGCTGG - Intronic
1065183395 10:23149117-23149139 GTATTTAGAACTGGAATTGCTGG + Intergenic
1066333244 10:34447965-34447987 ATATGCAGAAGCAGAATTGCTGG - Intronic
1067194548 10:44104880-44104902 ATATTCAGAAGCAGTATTGCTGG - Intergenic
1067413537 10:46085831-46085853 ATACCTAGAAGCAGAATTGTGGG + Intergenic
1067981017 10:51084301-51084323 GCAGTTAGAAGCAGAATGATAGG + Intronic
1069783539 10:70973310-70973332 ATATTTAGGAGTAGGATTGTTGG - Intergenic
1070044871 10:72822993-72823015 CTATCTAGGAGTAGAATTGTGGG - Intronic
1071964832 10:90842113-90842135 GTATTAAGAGGCAGACTTTTGGG + Intronic
1072260805 10:93670112-93670134 GTATTTCAAAGCAAAATTTTAGG - Intronic
1072837687 10:98734363-98734385 ATATCTAGAAGTGGAATTGTTGG + Intronic
1072904472 10:99439717-99439739 GTCTTTGGATACAGAATTGTGGG - Intergenic
1072937095 10:99723875-99723897 ATATCTAGAAGTAGAATTGCTGG - Intronic
1073940178 10:108688848-108688870 GTAATTAAAAGCAGAATTTAAGG + Intergenic
1073940325 10:108690625-108690647 TTTTTTAAATGCAGAATTGTGGG + Intergenic
1075247230 10:120833480-120833502 ATATTTAGAAGCATAAATATAGG + Intergenic
1075764556 10:124882551-124882573 TTATTTAGAAACAGAATGCTTGG - Intergenic
1075774241 10:124969590-124969612 GTATTTAAAAACAGTATTCTGGG - Intronic
1076548659 10:131263050-131263072 CAGTTTAGAAGCACAATTGTTGG + Intronic
1077619817 11:3710783-3710805 GTATGTTGGAGCAGAAATGTAGG - Intronic
1078683422 11:13502664-13502686 ATATTTAGAATCAAAAGTGTTGG - Intergenic
1078695891 11:13631171-13631193 ATACTTAGAAGTGGAATTGTTGG + Intergenic
1078783842 11:14467518-14467540 ATATCTAGAAGCAGAATTGCTGG - Intronic
1078921517 11:15835247-15835269 GTATTAAGAAGGAGAAGTCTGGG - Intergenic
1079736479 11:24003123-24003145 ATAATTAGAAGTGGAATTGTTGG - Intergenic
1079810927 11:24999227-24999249 GTTTTTAGAAGTATAATTGAAGG - Intronic
1079819105 11:25102639-25102661 GTATATAGGAGTAGAATTGCTGG + Intergenic
1080288908 11:30648743-30648765 TTATCTAGAAGTAGAATTGCTGG + Intergenic
1080598604 11:33800385-33800407 ATATTTAGAAGTAGAATTGCTGG - Intergenic
1081245229 11:40757868-40757890 GAATTTAGAGTCAGAAGTGTTGG + Intronic
1082228192 11:49732939-49732961 GTGATTAGATGCAGAAGTGTTGG + Intergenic
1083174204 11:60939125-60939147 GTATTTAGGCTCAGAATTGAAGG + Intronic
1084496619 11:69508672-69508694 ATACTTAGAAGCGGAATTGCTGG + Intergenic
1084852337 11:71951951-71951973 ATACCTAGAAGCAGAATTGCTGG - Intronic
1085150082 11:74244619-74244641 GTTTTTAGTTGCTGAATTGTAGG + Intronic
1085557095 11:77434118-77434140 ATATTTAGGAGTAGAATTGCAGG - Intronic
1085957433 11:81416701-81416723 GTATCTAGAAGTAGGATTGCAGG + Intergenic
1087476791 11:98646179-98646201 GTATTTTGAAGCAGAAATGTTGG + Intergenic
1087578358 11:100019699-100019721 ATACTCAGAAGTAGAATTGTTGG + Intronic
1087671949 11:101117106-101117128 GTTTCTAGAAGTAGAATTGTTGG + Intronic
1087716156 11:101611418-101611440 GTATTTAAAAGCAGAAATGTTGG + Intronic
1088248588 11:107842770-107842792 ATATCTAGAAGCAGAATTGCTGG - Intronic
1088415992 11:109589590-109589612 GTCTTCAGAAGCAGAATTGGTGG + Intergenic
1092189334 12:6507025-6507047 GTATGTAGAAGCCAAATTCTAGG - Intronic
1092922088 12:13241470-13241492 GTATTTAAAAGCAGTATTTTTGG - Intergenic
1093214176 12:16343835-16343857 GTATTTAGAAGCAGAATTGTTGG + Intergenic
1094032341 12:26026875-26026897 GTAATTAGGAGCAGAATTGCTGG - Intronic
1094391534 12:29956533-29956555 GTATGTAGGAGTAGAATTTTTGG - Intergenic
1095391599 12:41713584-41713606 GTATTTAGAAACCGAAATGTGGG + Intergenic
1095682102 12:44989778-44989800 ATACCTAGAAGCAGAATTGCTGG - Intergenic
1096830484 12:54310049-54310071 ATATGGAGAAGCTGAATTGTTGG - Intronic
1096831428 12:54317428-54317450 GTATTTAGGAGAGGAATTGCTGG - Intronic
1096909795 12:54971518-54971540 GTCTTTGGAAGGGGAATTGTTGG - Intronic
1097001706 12:55882520-55882542 GTATTTATAAGCAGATTTGGGGG + Intergenic
1097456820 12:59809184-59809206 CTATATTGAAGCAGAATTCTGGG - Intergenic
1097789368 12:63797883-63797905 ATATTTAGGAGCAAAATGGTCGG + Intronic
1098214033 12:68196746-68196768 CTTTCTAGAAGCAGGATTGTGGG - Intergenic
1098798954 12:74928578-74928600 ATGTTCAGAAGTAGAATTGTTGG - Intergenic
1098826398 12:75303003-75303025 ATACTTAGAAGTAGAATTGTTGG - Intronic
1098932579 12:76437121-76437143 GCATGTACCAGCAGAATTGTTGG - Intronic
1099040474 12:77646895-77646917 GTACTTAGAAGTGGAATTGATGG - Intergenic
1099477575 12:83125936-83125958 GTTTCTAGGAACAGAATTGTGGG - Intronic
1101008846 12:100429344-100429366 TTCTTTAGGAGCAGAATTGCTGG + Intergenic
1101804855 12:108054871-108054893 CTATTTGGAATCTGAATTGTTGG + Intergenic
1102655944 12:114482261-114482283 GTATTCAGAAGCAGATTTGAGGG + Intergenic
1102860383 12:116331120-116331142 GTATTTAGAGGTCAAATTGTAGG - Intergenic
1103586205 12:121958195-121958217 GCAATTAGAAGCAGAATAGCTGG + Intronic
1104400252 12:128470049-128470071 GTATTTGGAAGCAGATTAGTGGG - Intronic
1104772833 12:131374799-131374821 ATTTCTAGAAGTAGAATTGTTGG - Intergenic
1105893349 13:24698064-24698086 GGATCTAGAAGTAGAATTGCTGG + Intronic
1106148057 13:27069584-27069606 GTACCTAGAAGTAGAATTGCTGG - Intronic
1106910373 13:34456773-34456795 ATACTCAGAAGCAGAATTGCTGG - Intergenic
1107112349 13:36711671-36711693 ACATTTAAAAGAAGAATTGTAGG - Intergenic
1107209023 13:37829624-37829646 ATATCTAGAAGTAGAATTGCTGG - Intronic
1107507627 13:41050517-41050539 ATATCAAGAAGCAGAATTGCTGG + Intronic
1108390696 13:49944739-49944761 ATATCTAGAAGCAAAATTGCTGG + Intergenic
1108885275 13:55173519-55173541 CTATTGAGATGCAAAATTGTAGG - Intergenic
1109084806 13:57956353-57956375 ATATTCAGAAGTAGAATTGCTGG + Intergenic
1109602646 13:64652160-64652182 GTATCTATAAGCAGAATTCATGG + Intergenic
1110784505 13:79508254-79508276 ACATTTAGAAGTAGAACTGTTGG + Intronic
1111594407 13:90392857-90392879 TTATTTAGAGGTAGAATTATTGG - Intergenic
1113536281 13:111068695-111068717 ATATTTAGGAGTAGAATTGCTGG + Intergenic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1115082216 14:29468694-29468716 ATATTCAGAAGCAGAATTGCTGG + Intergenic
1115535092 14:34365536-34365558 GTATTTAAAAGCCGAGGTGTGGG - Intronic
1116030135 14:39561204-39561226 GTGTATAGAAGCACAATTCTTGG - Intergenic
1117165765 14:53031387-53031409 ATTTGTAGAAGCAGAATGGTTGG + Intergenic
1117902142 14:60545518-60545540 ATATCTAGGAGCAGAATTGCTGG + Intergenic
1117922794 14:60743006-60743028 ATATTTAGGAGTAGAATTATTGG + Intronic
1118084757 14:62401595-62401617 GAATTTTAAAGCAGAATAGTAGG - Intergenic
1118214380 14:63794886-63794908 GTATCTAGGAGTAGAATTATTGG - Intergenic
1118339907 14:64885951-64885973 CTATGTGGAAGCAGAATTGAAGG - Intergenic
1118634821 14:67738168-67738190 ATATTAAGAAGCTGAATTGCTGG - Intronic
1119019112 14:71091386-71091408 ACATCTAGAAGTAGAATTGTTGG - Intronic
1119766440 14:77192444-77192466 GAATTTAGAGGGAGGATTGTTGG + Intronic
1119916146 14:78403985-78404007 GTATTTGGAAGCTTAAATGTGGG + Intronic
1120223222 14:81759151-81759173 GCTTTTTGAAGCAGAATTTTAGG - Intergenic
1120554686 14:85915192-85915214 GTATATAGAAGCACAATTGCTGG + Intergenic
1120793460 14:88606968-88606990 GTATTGAGAATTAGAATTTTTGG + Intronic
1121621013 14:95348312-95348334 CTCTTTGGAAGCAGAAATGTGGG - Intergenic
1121959471 14:98245813-98245835 GTATTTAGAATAGGAAATGTTGG + Intergenic
1123891089 15:24780300-24780322 GTATATAGAAACAGAATTGCTGG + Intergenic
1123950770 15:25271831-25271853 GTACTTAGGAGCAGAATTGTTGG - Intergenic
1124029155 15:25993867-25993889 ATATTTAGGAGCAGACTTGAAGG + Intergenic
1124156714 15:27232623-27232645 ATGATTAAAAGCAGAATTGTAGG - Intronic
1126123803 15:45277311-45277333 GTATGTAGGAGTGGAATTGTGGG - Exonic
1126386033 15:48094331-48094353 GTCTTTATAAGAAGAAGTGTGGG - Intergenic
1127948195 15:63776487-63776509 ATCTTTAGAAGAGGAATTGTTGG - Intronic
1128998700 15:72315969-72315991 GTATTTCGAAGAAGAATAGTTGG - Intronic
1131132905 15:89911591-89911613 ATATTTAGAAAAATAATTGTGGG - Intronic
1131159664 15:90096959-90096981 ATATACAGAAGCAGAATTGCTGG - Intronic
1131455128 15:92577456-92577478 ATTTTTAGAAGCAGAATTTCTGG - Intergenic
1131700641 15:94931928-94931950 GTGTGTAGAATCAGAACTGTTGG + Intergenic
1131875080 15:96797171-96797193 GAATATAGAAGAAGAATTGAAGG + Intergenic
1132228073 15:100159102-100159124 ATATTTTGAAATAGAATTGTTGG - Intronic
1134398110 16:13884122-13884144 GTATTTAGGAGTGAAATTGTTGG - Intergenic
1135209797 16:20515263-20515285 GCATTTGGAAGGAGAACTGTTGG - Intergenic
1135400250 16:22162185-22162207 ATATGTAGGAGCAGAATTGCTGG - Intergenic
1138127464 16:54450769-54450791 ATTCTTAGAAGCAGAATTGCTGG + Intergenic
1138304592 16:55962817-55962839 GTAATGAGATGCATAATTGTAGG - Intergenic
1138609015 16:58108280-58108302 GTATTAAGATGCAGATTTCTGGG + Intergenic
1138751210 16:59423570-59423592 GTATTTAGAAGTAGAATTACTGG + Intergenic
1138897156 16:61220819-61220841 GTCTTTAGAAGTAAAATTCTTGG + Intergenic
1140004805 16:71064302-71064324 ATATTTATAAGTAGATTTGTTGG - Intronic
1140998713 16:80287499-80287521 GTACCTAGAAGCAGAATTGCTGG - Intergenic
1141236870 16:82226706-82226728 GAATTTAGCAGTAGATTTGTAGG + Intergenic
1141834706 16:86531227-86531249 GTTTTTAGAAACAGAACTGGAGG + Exonic
1142685051 17:1572735-1572757 GCATTGAGAAACAGAATTGAGGG - Intronic
1143912767 17:10265568-10265590 ATGGTTAGAAGCAGAATTGGGGG - Intergenic
1143930351 17:10416464-10416486 ATACTCAGAAGTAGAATTGTGGG + Intronic
1144279005 17:13705777-13705799 GTATTCAGGAGCAGAATTGCTGG + Intergenic
1144286669 17:13782126-13782148 ATGATTAGAAGCAGAATTTTTGG - Intergenic
1145065902 17:19761151-19761173 ATAATCAGAAGCAGAATTGCTGG + Intergenic
1146437599 17:32865692-32865714 GTATCAAGGAGCAGAAATGTGGG + Intronic
1146755025 17:35422539-35422561 GTATTTAAGACCAGAATTGCTGG - Exonic
1147838716 17:43354937-43354959 ATACTTAGAATCAGTATTGTGGG + Intergenic
1149061478 17:52427905-52427927 GTATCCAGTAGCAGAATTATCGG - Intergenic
1149876385 17:60237936-60237958 ATATTTAGAAGTAGAATTGCTGG + Intronic
1150017207 17:61570181-61570203 GTACTTAGGAGCGGAATTGCTGG + Intergenic
1150035972 17:61798024-61798046 CTTTTTAGAAGTGGAATTGTTGG - Intronic
1150063256 17:62086909-62086931 GTATCTAGGAGTAGAATTGTTGG - Intergenic
1151242126 17:72766330-72766352 ATACTTAGAAGAAGAATTGCTGG + Intronic
1151393933 17:73807362-73807384 ATATGTAGAAGTAGAATTGTTGG - Intergenic
1153162616 18:2225513-2225535 GTATTTAGAAGTAAAATTGCTGG + Intergenic
1153254642 18:3158420-3158442 GTTCTTAGAACTAGAATTGTTGG + Intronic
1153326352 18:3824257-3824279 GTGTTCAGAAGCAGAGATGTGGG + Intronic
1153345644 18:4022697-4022719 ATATTTAGCAGTAGAATTGGTGG + Intronic
1153622473 18:6991688-6991710 ATATTAAGAAGTAGAATTATTGG - Intronic
1153649414 18:7226549-7226571 TTATTAAGGAGCACAATTGTGGG - Intergenic
1153721793 18:7911276-7911298 ATACTTAGGAGCAGAATTGCTGG + Intronic
1153922185 18:9801612-9801634 GTATCTAGAAGTGAAATTGTTGG + Intronic
1155013779 18:21811348-21811370 ATATTCAAAAGCAGAACTGTTGG - Intronic
1155083912 18:22437206-22437228 GTATTTAGGAGTAGAATTGCTGG + Intergenic
1155447813 18:25930218-25930240 TTTCTTAAAAGCAGAATTGTGGG - Intergenic
1155632839 18:27914611-27914633 ATATCTACAAGAAGAATTGTGGG - Intergenic
1156245983 18:35298756-35298778 ATATCTAGAAGTAGAATTGCTGG + Intergenic
1156397435 18:36711087-36711109 GTATTTAGAAGCAGAAATTAGGG + Intronic
1157073856 18:44442758-44442780 GTATCCAGAAGTAGAATTGTTGG - Intergenic
1157120623 18:44907365-44907387 ATACTTAGGAGCAGAATTTTGGG + Intronic
1157681049 18:49607256-49607278 TTACTTAGGAGTAGAATTGTTGG - Intergenic
1157708630 18:49831736-49831758 ATATTTAGAGGCAGAATTACTGG - Intronic
1157968165 18:52233339-52233361 GTATTTTGAAGCATTTTTGTTGG - Intergenic
1158786758 18:60722186-60722208 GTATTTAGAAACCGAGTTCTTGG - Intergenic
1159361524 18:67410800-67410822 GAATTCACAAGCAGAATTCTTGG + Intergenic
1159417531 18:68172720-68172742 ATATTTTGAAGCAAAATTTTGGG + Intergenic
1159975962 18:74712210-74712232 GTATTTAGAATTAGAAGTCTTGG + Intronic
1159978766 18:74750723-74750745 GTATATAGGAGTAGAATTGCTGG + Intronic
1160166344 18:76515927-76515949 ATACCTAGAAGCAGAATTGCTGG - Intergenic
1160327449 18:77964090-77964112 GTTTTTATAAGTAAAATTGTTGG - Intergenic
1161834223 19:6634330-6634352 GTACATAGAAGTAGAATTGCTGG - Intergenic
1162218274 19:9154732-9154754 ATATCTAGGAGCAGAATTGTTGG + Intronic
1162865668 19:13544788-13544810 AGGTTTAGAAGCAGAATTGGAGG - Intronic
1164471011 19:28532529-28532551 ATACCTAGAAGTAGAATTGTTGG - Intergenic
1165540386 19:36488542-36488564 TTATTTACCAGCAGAATTGCCGG - Intronic
1166640934 19:44494885-44494907 ATATTTAGAAGGTGAAATGTGGG + Intronic
1167838182 19:52092284-52092306 GTATTTTGCTGTAGAATTGTAGG - Intronic
1168564188 19:57409317-57409339 ATATCTAGAAATAGAATTGTAGG + Intronic
926187712 2:10704371-10704393 GTATTTAGGAGCGGAATTGCTGG - Intergenic
926984056 2:18601981-18602003 GTATTTAGAAGTCGATATGTAGG + Intergenic
927335930 2:21924264-21924286 ATACTTAGATGTAGAATTGTGGG + Intergenic
927423990 2:22960703-22960725 GTATTTAGAGGCAGAAAAGTAGG - Intergenic
928156825 2:28884394-28884416 ATACTTAGAAGCAGAATTGCTGG + Intergenic
928358893 2:30647203-30647225 GTTCTTAGAAGCAGGATTGTGGG - Intergenic
929117246 2:38454985-38455007 GTACCTAGGAGCAGAATTGCTGG + Intergenic
929154824 2:38779981-38780003 GTATTTATAAACAAAATTATAGG - Intronic
929184353 2:39078425-39078447 GTACTTAGAAGTAGAATTGCTGG - Intronic
929337639 2:40769608-40769630 ATATTTTGTAGCGGAATTGTTGG + Intergenic
929619353 2:43338860-43338882 GTATTCAAAAGTGGAATTGTTGG + Intronic
930226622 2:48800695-48800717 GTATTTAGGATCAAAAATGTTGG + Intergenic
930250440 2:49028718-49028740 GTATGGAGAAGCACAATGGTGGG - Intronic
930520806 2:52464703-52464725 ATATCTAGAAGTAGAACTGTTGG - Intergenic
930551906 2:52846481-52846503 ATACTTAGGAGCAAAATTGTTGG + Intergenic
930732477 2:54741538-54741560 GTCTTTAGAAACTGAATTCTTGG - Intronic
931343818 2:61427710-61427732 GTCTTTTGCAGCAGAATTGATGG + Intronic
931601096 2:64003889-64003911 GTATTTAGAAACAGAAGTCTGGG - Intronic
932085996 2:68761864-68761886 ATATTTAGATGCGGAATTGTGGG - Intronic
932473073 2:71976572-71976594 ATATATAGAAGTAGAATTGCTGG - Intergenic
932725390 2:74175568-74175590 ATATTTAGAAGTAGAATGGATGG - Intronic
932725537 2:74176910-74176932 ATACTTAGGAGCAGAATTGCTGG - Intronic
933443584 2:82347992-82348014 GCTTTTAGAAGCAGAAATATTGG - Intergenic
933563661 2:83921798-83921820 GTATTTAGAAGCCAAAATCTGGG - Intergenic
933827371 2:86174966-86174988 GTTTTCAGAAGAGGAATTGTTGG + Intronic
934072667 2:88398998-88399020 GTATCTAGAAGTGGAATTGCTGG - Intergenic
934091344 2:88553268-88553290 GTTGTTAGAAGTAGAGTTGTTGG + Intergenic
936686515 2:114833629-114833651 GTATTAAGAGGCAGACTTGGAGG - Intronic
937005474 2:118508715-118508737 GTACTTAGGAGTAGAATTGCTGG - Intergenic
937564451 2:123266978-123267000 GTTTTAAGCAGAAGAATTGTGGG - Intergenic
938826940 2:135015056-135015078 GTATTTAGGAGCAGAATTGCTGG + Intronic
939610173 2:144300403-144300425 GTATTTAGGAGTGGGATTGTTGG - Intronic
940062758 2:149590669-149590691 ATATCTAGAAGCACAATTGCTGG + Intergenic
940181546 2:150939642-150939664 TTATATAGAACCAGAATTGTAGG + Intergenic
941102020 2:161307257-161307279 GTATTTAGAAGGGGAAGTGGTGG + Intergenic
942216776 2:173728883-173728905 ATATTTAGAAGTGGAATTGTTGG - Intergenic
942267057 2:174238696-174238718 ATATTTAGAAGTAGAATTTCTGG - Intronic
943452426 2:188060154-188060176 GTATTTATAAGCATAAAAGTTGG + Intergenic
943916197 2:193635591-193635613 ATTTTTAGAATCAGAATTGGAGG - Intergenic
944253826 2:197604253-197604275 GTTTCTAGAAGCAGAATTGCTGG - Intronic
945041756 2:205748544-205748566 GTATTTAATAGCAGAAAGGTGGG + Intronic
945240248 2:207670013-207670035 GTAGCTAGAAGTAGAATTGCTGG + Intergenic
945710312 2:213286806-213286828 GTATTTAAAAGCAGAAAAGTGGG - Intronic
945765492 2:213971666-213971688 ATTTTTAGAAGCAGAGTTGCTGG - Intronic
945983585 2:216336833-216336855 TTTATTTGAAGCAGAATTGTTGG - Intronic
946826276 2:223681520-223681542 ATATCTAGGAGCAGAATTGCTGG - Intergenic
947292253 2:228588930-228588952 GTGTCCAGAAGCAGAATTGTTGG + Intergenic
947820730 2:233067554-233067576 ATATCTAGGAGCAGAATTGCTGG + Intronic
948308653 2:236968844-236968866 TTCTTTGCAAGCAGAATTGTAGG - Intergenic
948546395 2:238732471-238732493 GTACTTAGGAGCACAATTGCTGG + Intergenic
1169056461 20:2625751-2625773 ACATCTAGAAGCAGAATTGTGGG + Intronic
1169939055 20:10917258-10917280 ATATTCAGAAGTAGAATTATTGG - Intergenic
1170520110 20:17176275-17176297 GAATCTAGAAGCAGACTTGAAGG + Intergenic
1171126772 20:22609303-22609325 AGAACTAGAAGCAGAATTGTGGG - Intergenic
1171378326 20:24711166-24711188 GTACTTAGAAGTGGAATTGCTGG + Intergenic
1171565345 20:26179652-26179674 ATATTTGGAAGTGGAATTGTGGG - Intergenic
1172172462 20:32947118-32947140 GTATTTAGAAGCAGAATGGCTGG + Intronic
1172755666 20:37282486-37282508 GTATTGAGAAGCTGAATGATGGG - Intergenic
1172784969 20:37462277-37462299 GTATATAGAAGAGGAATTGCTGG + Intergenic
1172790327 20:37500320-37500342 ATACTTAGAAACAGAATTGATGG - Intronic
1173231703 20:41203739-41203761 GTATTTAGAACCGTAATTGTGGG + Exonic
1173244534 20:41326855-41326877 GTATTTTGGAGCAGAATTTCTGG - Intergenic
1173378803 20:42516646-42516668 GTACTTAGAAGTAGAATTAATGG + Intronic
1177105921 21:16955335-16955357 GGATTTAGAAGCTAAATTGCTGG + Intergenic
1177113793 21:17061154-17061176 CCACTTAGAAGCAGAATTGAAGG + Intergenic
1177274892 21:18897572-18897594 GTATTAAGAGGAAAAATTGTGGG + Intergenic
1177964048 21:27705060-27705082 ATACTTAGAAGTAGAATTGCTGG - Intergenic
1178039733 21:28626867-28626889 ATACTTAGGAGCAGAATTGTTGG - Intergenic
1178716930 21:34973603-34973625 GGATTTACAAGCAGATTTATAGG - Intronic
1179637499 21:42722799-42722821 ATTTTTAGAATCAGAATTATGGG + Intronic
1180974329 22:19838797-19838819 ATATCTAGGAGTAGAATTGTTGG - Intronic
1182025671 22:27116552-27116574 TTATTTAGAAACAGCAGTGTGGG + Intergenic
1182141972 22:27967344-27967366 GTTTTTAGAAGCCGAGTTCTGGG + Intergenic
1182261565 22:29075918-29075940 GTAATTAGAAGTAGGATTGATGG - Intronic
1182631193 22:31686843-31686865 GAATATAGAAGGAGAATTGTAGG - Intronic
1182983044 22:34690167-34690189 ATATCTAGAAGCATTATTGTTGG - Intergenic
1183141840 22:35949396-35949418 ATATTCAGAAGCAGAACTGCTGG + Intronic
1183258869 22:36781235-36781257 GGGTGTAGTAGCAGAATTGTTGG + Intergenic
1183487009 22:38093827-38093849 GTATATAAGAGTAGAATTGTGGG - Intronic
1183897288 22:40979443-40979465 ATATCGAGAAGTAGAATTGTTGG + Intergenic
1184736913 22:46404462-46404484 ATATTTAGAAGTAGATTTCTAGG - Intronic
1184985298 22:48128759-48128781 GTGTGTAGAAGCAGAATTAGAGG - Intergenic
949357895 3:3201333-3201355 GAGTTTAGAAGCATAGTTGTGGG - Intergenic
949932998 3:9094481-9094503 ATATTTAGAAGTAAAATTGTTGG + Intronic
949938183 3:9133818-9133840 CTATTTAGAAGCAGACATGCTGG + Intronic
950197493 3:11019128-11019150 CTACTCAGAAGCAGAATTGCTGG - Intronic
950208655 3:11100134-11100156 ATACCTAGGAGCAGAATTGTTGG + Intergenic
950266614 3:11577898-11577920 GTAATTTGAAGGAGAATTCTGGG - Intronic
950622672 3:14218480-14218502 GTACTTAGGAGCAGAATGGCTGG + Intergenic
951022489 3:17796222-17796244 ATATTTAGAAGTGGAATTGCTGG + Intronic
951748701 3:26009200-26009222 GTACTTAGAAGTGGAATTGATGG + Intergenic
951895216 3:27603454-27603476 ATATTTAGAAGTAGAATTTTGGG + Intergenic
953139812 3:40218117-40218139 ATACTTAGGAGTAGAATTGTTGG - Intronic
953935787 3:47040981-47041003 GTACTTAGAAGTGGAATTGTTGG - Intronic
954835793 3:53466634-53466656 ATATGTAGAAGTAGAATTGCTGG + Intergenic
956457562 3:69438453-69438475 GGATATAGAAGCAAAATTGTAGG + Intronic
956459037 3:69453447-69453469 GTATGTAAAAGCAGATTTCTTGG + Intronic
956616128 3:71174590-71174612 GTATTCAGAAACAGTCTTGTGGG - Intronic
957184409 3:76923245-76923267 GTGTTCAGAAGCAGAATGGCGGG - Intronic
958980385 3:100712208-100712230 GTATTTATATGAAGAATAGTAGG + Intronic
959907202 3:111723029-111723051 GCATTTAGCATCAGAATTGAAGG - Intronic
959913088 3:111787110-111787132 TTATGTAGTAGCATAATTGTTGG - Intronic
960231823 3:115237423-115237445 ATATCTAGTAGTAGAATTGTTGG + Intergenic
960451424 3:117813549-117813571 GTTTTTGAAAGCAGATTTGTTGG - Intergenic
960979251 3:123206365-123206387 GTATTTAAAAGCAGATTGGATGG - Intronic
960999265 3:123362176-123362198 ATATCTAGGAGCAGAATTGCTGG + Intronic
961366133 3:126400819-126400841 ATATCTAGAAGTAGAATTGCTGG - Intronic
961907641 3:130278981-130279003 GCATTTAGAAGCAGAATAATTGG + Intergenic
962128366 3:132646570-132646592 ATATGTAGAAGCAGACTTGCTGG - Intronic
963809394 3:149760124-149760146 GTATCTAGGAGTAGAATTGTTGG - Intergenic
963853589 3:150231732-150231754 GTATCTAGAAGCTAAACTGTTGG - Intergenic
964211627 3:154234665-154234687 GAATTGTGAAGCAGAATAGTGGG - Intronic
964226353 3:154407800-154407822 GTATTTAGAAGCCAAAATCTGGG - Intronic
964364572 3:155935499-155935521 TTATTTAGAAGCAACATTATAGG - Intronic
964941469 3:162161373-162161395 GTATTTAAGAACAAAATTGTAGG - Intergenic
965376107 3:167926309-167926331 GTATTAAGAGGCAAAATGGTGGG + Intergenic
965989200 3:174795550-174795572 ATATTTAGGAGTAGAATTGTTGG + Intronic
966277274 3:178188986-178189008 GTATGTAGGAGTAGAATTTTAGG - Intergenic
966580210 3:181552924-181552946 ACTTTTAGAAGCAGAATTGTTGG - Intergenic
966699285 3:182827856-182827878 GAATTTAGTAGCAAAATTGTTGG + Intronic
966890368 3:184403190-184403212 ATATTTAGAAGTGGAATTGCTGG + Intronic
968536618 4:1134844-1134866 GGATCTAGGAGCAGAATTGCTGG + Intergenic
968839034 4:2987638-2987660 GTACTCAGAAGCAGAATTGTTGG + Intronic
969194462 4:5549659-5549681 GTATTTGGAATCAGAATTCTGGG - Intronic
970495572 4:16621504-16621526 TGATTTAGAAGCATAATTTTTGG - Intronic
970556307 4:17236215-17236237 GTTTTTAGAAGTAAAATTGCTGG - Intergenic
970668248 4:18363325-18363347 ATATTTAGAAGCATGATTGCTGG + Intergenic
970757267 4:19441993-19442015 TTATTTTGAATCAAAATTGTTGG + Intergenic
971296684 4:25400154-25400176 GTAGATGGAAGCAGAATTGCTGG + Intronic
971346113 4:25813175-25813197 GTATCCAGAAGCAGAATTTCTGG - Intronic
971352360 4:25864888-25864910 GTATATGGAAGGAAAATTGTCGG + Intronic
971381726 4:26105072-26105094 GTATTTAGAAGGGAACTTGTGGG - Intergenic
971511070 4:27424611-27424633 GTATTTAGAAATAGACTTGATGG + Intergenic
972143637 4:35994022-35994044 GTACTTAAAAGTAGAATTATTGG - Intronic
972354844 4:38270735-38270757 GTATTTAGAGGCAACAATGTGGG + Intergenic
973029645 4:45320638-45320660 TTATTTAGAAGTAGAATTGCTGG + Intergenic
973102163 4:46286459-46286481 ATATTTAGAGGTAGAATTGCAGG + Intronic
974281672 4:59803275-59803297 GTATCTAGAAGTAGATTTTTTGG - Intergenic
974350496 4:60738188-60738210 CTATATAGAAGCAGAATTCATGG + Intergenic
974796917 4:66764986-66765008 ATATCTAGAAGTGGAATTGTTGG + Intergenic
975580192 4:75899779-75899801 ATATTTAGGAGCAGTTTTGTTGG - Intronic
976537149 4:86231351-86231373 CTATATAGAAGTACAATTGTAGG + Intronic
976726436 4:88220321-88220343 ATATCTAGAAGTGGAATTGTGGG + Intronic
976768375 4:88622495-88622517 GTACCTAGAAGTGGAATTGTTGG + Intronic
976813272 4:89119903-89119925 GTAGTTAGTGTCAGAATTGTAGG - Intergenic
977013674 4:91664703-91664725 GTAATTAGAAGTGGAATTGTTGG + Intergenic
977290927 4:95163469-95163491 GTGTGTAGAAGATGAATTGTAGG - Exonic
977501034 4:97837227-97837249 GATCTTAGAAGCAGAATTCTAGG + Intronic
978078063 4:104558068-104558090 GCATGAAGAAGCAGAATTGGCGG + Intergenic
978402420 4:108344677-108344699 GTATTTTGAAACAGCATTTTGGG - Intergenic
979187791 4:117820040-117820062 ATATTTAGGAGTAGAATTGCTGG - Intergenic
979352325 4:119658804-119658826 ATATTTAGGAGTAGAATTGCTGG + Intergenic
980282725 4:130741394-130741416 ATACTTAGAAGTAGAATTGCTGG + Intergenic
980438185 4:132808342-132808364 ATATCTAGAAGTAGGATTGTTGG - Intergenic
981250025 4:142589755-142589777 ATATTTGGAAGCACAATTGCTGG - Intronic
982297288 4:153842391-153842413 ATATGTAGAAGCAGAATTGCTGG + Intergenic
983798264 4:171893902-171893924 GTATTTTGAGACTGAATTGTGGG - Intronic
984235912 4:177158680-177158702 GTATCTAGAAGTAGGATTGCTGG - Intergenic
985272133 4:188203624-188203646 GGCTTAAGAAGCAGAATTATGGG - Intergenic
985365019 4:189220762-189220784 ATATCTAGAATTAGAATTGTGGG - Intergenic
985419250 4:189766956-189766978 TTATTAAGAAGCAAAACTGTTGG - Intergenic
985816009 5:2128575-2128597 GTTTTTAGAAGCAGAATTTTGGG + Intergenic
986187014 5:5453191-5453213 GTATTTGGAAGCAGGCTTTTGGG + Intronic
986652865 5:9981767-9981789 ATACTTAGAAGTGGAATTGTGGG - Intergenic
986789701 5:11147834-11147856 ATACCTAGAAGCAGAATTGATGG - Intronic
987809036 5:22809761-22809783 GTGTTTAGAAGCAGTATTTTTGG - Intronic
987931778 5:24409889-24409911 TTCTTTAAAAGCATAATTGTTGG - Intergenic
988371200 5:30369862-30369884 ATATCTAGAAGCAGAATTCCTGG - Intergenic
988384688 5:30546719-30546741 ATATTTAGGAGTAGGATTGTTGG - Intergenic
988892381 5:35631589-35631611 ATATCTAGAAGTAGAATTGTTGG - Intronic
989674609 5:43958950-43958972 AAATTCAGAAGCAGATTTGTTGG + Intergenic
989702279 5:44283905-44283927 ACATTTAGGAGTAGAATTGTTGG - Intergenic
990010738 5:50994535-50994557 ATATCAAGAAGCAGAATTGAAGG + Intergenic
990573894 5:57106410-57106432 GTTTTTAGAAGAGGAAATGTTGG - Intergenic
990606249 5:57413326-57413348 ATATCTAGAAGTAGAATTGCTGG + Intergenic
992223786 5:74598675-74598697 CTTTTTAGAAGCAAAATTCTTGG - Intergenic
992341243 5:75825609-75825631 TTATTTAGAGGCAGAACTGAGGG + Intergenic
992788920 5:80196509-80196531 ATATCTAGAAGCAGAATTGCTGG - Intronic
993272446 5:85812828-85812850 GCATTTAGAAGCAAAATGGCCGG + Intergenic
993284144 5:85968023-85968045 ATATCTAGAAGTAGAATTGCTGG + Intergenic
993819603 5:92598379-92598401 GTATTTTGAATCTGAATTTTAGG - Intergenic
994207393 5:97050689-97050711 ATAGTTAGAAGCACAATTCTGGG + Intergenic
994952711 5:106484992-106485014 ATAGTTAGAAGTAGAATTATGGG + Intergenic
994964407 5:106649866-106649888 GTATTGGGAAGCATAAATGTGGG + Intergenic
996268079 5:121567523-121567545 ATATTCAGAATCAGAATTGTTGG - Intergenic
996322643 5:122236254-122236276 GTGTTTAAAAGGAGAATTTTGGG - Intergenic
996851966 5:127963202-127963224 GTACTTAGAAAAAGAATTTTGGG + Intergenic
997291538 5:132739585-132739607 ATATGTAGAAGTAGAATTGCTGG + Intergenic
998441658 5:142167806-142167828 CTATATTGCAGCAGAATTGTGGG + Intergenic
999511161 5:152253689-152253711 GTATGTAGAAATAGAATTGCTGG + Intergenic
999846739 5:155489987-155490009 CTATTTAGAAGTAGAATGGTTGG + Intergenic
1000106366 5:158063245-158063267 ACATTTAGGAGCGGAATTGTTGG + Intergenic
1000467140 5:161593671-161593693 ATATCTAGAAACAGAATTGATGG - Intronic
1001308298 5:170591957-170591979 GTATCCAGAAGCAGAATTCTTGG + Intronic
1003270016 6:4600321-4600343 GTATTAGGAAGTAGAATTGCTGG + Intergenic
1003274215 6:4634872-4634894 ATTCTTAGAAGCAAAATTGTTGG - Intergenic
1003329127 6:5115211-5115233 GTTTCTAGAAGTAGAATTGTTGG + Intronic
1005093709 6:22087183-22087205 ATATCTAGAAGTAAAATTGTAGG - Intergenic
1005424394 6:25686227-25686249 ATATTAAGGAGCAGAATTTTTGG + Intronic
1006538165 6:34717038-34717060 ATATCTAGAAACAGAATTGCTGG - Intergenic
1006747363 6:36352828-36352850 ATACTTAGAAGCAGGATTGCTGG + Intergenic
1006989720 6:38204202-38204224 GTATCTTGAAGTAGAATTTTTGG - Intronic
1009324545 6:62334311-62334333 ATATCTAGAAGCAGAAATATTGG - Intergenic
1009620313 6:66066349-66066371 ATATCTAGTAGCAGAATTGCTGG + Intergenic
1010769127 6:79808426-79808448 CCAATTAGTAGCAGAATTGTAGG - Intergenic
1011414018 6:87098148-87098170 GTTTTTAGAAGTGGAATTGTTGG + Intergenic
1011571651 6:88743803-88743825 ATTTTCAGAAGCAGAATTGCTGG + Intronic
1011776143 6:90732847-90732869 ATACTTAGAAGTAGAATTGCTGG + Intergenic
1012621169 6:101345692-101345714 ATGCATAGAAGCAGAATTGTTGG - Intergenic
1013598032 6:111678695-111678717 GGATTGAGAAGCCAAATTGTGGG - Intronic
1014164258 6:118205625-118205647 GTATCTAGAAGTGGAATGGTTGG - Intronic
1014273131 6:119356386-119356408 GTATCTAGGAGTGGAATTGTTGG - Intergenic
1014456304 6:121638476-121638498 GTGCTTGGAAGCAGAAATGTTGG + Intergenic
1014729176 6:125010887-125010909 GTATTTAACTGCAGAATTTTAGG - Intronic
1015380839 6:132566344-132566366 ATATCTAGATGCAGAATTGATGG - Intergenic
1015655908 6:135518921-135518943 GTATTTACAAGGAGACTTGAAGG - Intergenic
1016327985 6:142924944-142924966 GTATTTAGTAGTAGTATTATAGG - Intronic
1017585169 6:155912650-155912672 GTATTCAGGAGCAAAATTGCTGG + Intergenic
1018018022 6:159729330-159729352 ATATTTAGAGGCAGAAAAGTTGG - Intronic
1018165310 6:161088522-161088544 GAATATAAAAGCAGAGTTGTTGG - Intronic
1018584219 6:165337625-165337647 CTATTTAGAAGCAATATGGTTGG + Intronic
1019457951 7:1140869-1140891 GTATTTAGGAGCAGTGTTCTGGG - Intergenic
1019761492 7:2816003-2816025 GTACTTAGACGCAGAGTTGCTGG - Intronic
1019899501 7:4008908-4008930 ATACTGAGAAGCAGAATTGCTGG + Intronic
1020229321 7:6305522-6305544 GTATTTGGAAACAGAAAAGTAGG - Intergenic
1021048189 7:15949526-15949548 GTATTTAGAAACAAATGTGTGGG - Intergenic
1022299724 7:29091595-29091617 GTATGTGGAAGCAGAAGTGTGGG + Intronic
1022435472 7:30380113-30380135 GTATTTAGAAGTACAATTGCTGG + Intronic
1022896503 7:34755135-34755157 GTAACTAGAAGCAGAATTGCTGG + Intronic
1023008069 7:35896288-35896310 ATATTTACAATCATAATTGTTGG + Intronic
1023071261 7:36436483-36436505 ATACATAGGAGCAGAATTGTGGG + Intronic
1023712032 7:43005283-43005305 GTACTCAGAAGTAGAATTGCTGG + Intergenic
1023819719 7:43973840-43973862 ATGTCTAGAAGCAGAATTGCTGG + Intergenic
1024567779 7:50696792-50696814 GTATCTAGAAGTGGAATTGCTGG - Intronic
1024876506 7:54030287-54030309 GTATTTATAAGCAGTCTTGCTGG - Intergenic
1025195627 7:56930312-56930334 GTACCTAGAAGTAGAATTGCTGG + Intergenic
1025272111 7:57532209-57532231 ATATTTGGAAGTGGAATTGTGGG + Intergenic
1025676323 7:63646627-63646649 GTACCTAGAAGTAGAATTGCTGG - Intergenic
1026130028 7:67612522-67612544 GTATTTAGGAGCGGAATTGTTGG - Intergenic
1026397878 7:69976482-69976504 GTATGTAGAAGTGGGATTGTTGG + Intronic
1027306356 7:76902005-76902027 GGATCTAGAAGCAGATTTGGAGG - Intergenic
1027650151 7:80856706-80856728 TTATCTAGGAGCAGAAGTGTTGG - Intronic
1028861187 7:95652482-95652504 ATACTTAGAAGTAGAATTGTGGG + Intergenic
1029013327 7:97286290-97286312 ATACCTAGAAGTAGAATTGTTGG + Intergenic
1029747992 7:102527293-102527315 ATGTCTAGAAGCAGAATTGCTGG + Intergenic
1029765941 7:102626388-102626410 ATGTCTAGAAGCAGAATTGCTGG + Intronic
1029793498 7:102870017-102870039 GTATTTAGTAGTAGATTTTTTGG + Intronic
1029795017 7:102885141-102885163 ATATTTAGGAGAAGAATTGCTGG + Intronic
1030250278 7:107435777-107435799 ATATATAGAAGTAGAATTGGTGG - Intronic
1030511088 7:110482681-110482703 GTACTTAGAAGTAGAATTGCTGG - Intergenic
1031786855 7:126044369-126044391 GTATTTAGATGAAAAGTTGTGGG + Intergenic
1031919409 7:127589780-127589802 CTCTTTAGAAGCAGGATTCTGGG + Intronic
1032413304 7:131716249-131716271 GTTTTTAGAAAGAAAATTGTGGG + Intergenic
1032646819 7:133834099-133834121 CTTATTTGAAGCAGAATTGTGGG + Intronic
1034144466 7:148856536-148856558 GTATTTAGAAACAAAAGTCTTGG - Intronic
1035946343 8:3967652-3967674 GTATTGACAAGGACAATTGTAGG - Intronic
1036226363 8:6961278-6961300 GTCTTTAGAAGTAGAATTCTGGG + Intergenic
1036483183 8:9155190-9155212 GTGTTTAGCAGCAGAGTTGGGGG + Intronic
1036989121 8:13571718-13571740 ATACTTAGAAGTAGAATTGCTGG + Intergenic
1037293531 8:17376447-17376469 ATACTTAGGAGCAGAATTGCTGG + Intronic
1037402962 8:18511871-18511893 ATATCTAAAAGTAGAATTGTTGG - Intergenic
1037523058 8:19698800-19698822 ATACTTAGAAGCAAAATTGCTGG - Intronic
1037637278 8:20711269-20711291 GGCTTTGGAAGCAGCATTGTGGG - Intergenic
1037780665 8:21866597-21866619 GTACATAGGAGCTGAATTGTGGG - Intergenic
1039009075 8:33073560-33073582 GTGTTTAGAAGGAGAATTAAGGG + Intergenic
1040506797 8:48056363-48056385 ATATTTAGGAGTGGAATTGTTGG + Intronic
1040583237 8:48714792-48714814 GTTTGTAAAAGTAGAATTGTTGG - Intronic
1040885385 8:52257293-52257315 CTACTTAGAAGAAGAATTGCTGG + Intronic
1040957910 8:52998329-52998351 ATATTTAGCAGCACAATTCTAGG - Intergenic
1041448283 8:57977966-57977988 ATATCTAGAAACAGAATTGCTGG + Intergenic
1041604029 8:59759308-59759330 TTATTTAGACACAGAATTCTAGG - Intergenic
1041653507 8:60324994-60325016 CTATTTAGTATCAGAATTATGGG + Intergenic
1041902764 8:63000090-63000112 ATATCAAGAAGCAGAATTGCTGG - Intergenic
1041995355 8:64049885-64049907 GTATTTAGATGCACAATTTAAGG + Intergenic
1042251954 8:66765072-66765094 ATATCTAGAAGTAGAATTGCTGG + Intronic
1042436253 8:68768538-68768560 TCATTGAGAACCAGAATTGTTGG - Intronic
1042445029 8:68873748-68873770 TCATTTAGAAGAAGAATTCTGGG - Intergenic
1042783220 8:72515876-72515898 GTAGCTAGAAGTGGAATTGTAGG - Intergenic
1043701929 8:83300258-83300280 GTTTTTAAAAGCAGATTTCTGGG + Intergenic
1044029336 8:87214961-87214983 GTATTTAGGAGTGGAATTCTGGG - Intronic
1044627316 8:94246695-94246717 GTATTTGTAAGCAAAAATGTAGG + Intergenic
1044816923 8:96122997-96123019 ATACTCAGAAGCAGAATTGCTGG + Intergenic
1045725265 8:105165429-105165451 GTATTAAGAACCAGGACTGTTGG + Intronic
1046785481 8:118261291-118261313 GAATTCAGGAGAAGAATTGTTGG - Intronic
1046931775 8:119848595-119848617 GTACCTAGGAGCAGAATTGATGG - Intronic
1047438175 8:124852911-124852933 GTAATTAGAAGTGGAATTGTTGG - Intergenic
1047890002 8:129297476-129297498 ATATCTAGAAGTAGAATTGCAGG + Intergenic
1048398580 8:134040187-134040209 ATATCTAGAAGTAGAAATGTTGG - Intergenic
1049194906 8:141309533-141309555 GTATCTAGGAGCAGAATTGCTGG - Intergenic
1050419003 9:5443189-5443211 ATATGTAAAAGCAGAATTGCTGG + Intergenic
1050485124 9:6126076-6126098 GTATCTAGAAGTAAAATTGCTGG - Intergenic
1051368893 9:16341548-16341570 GTCCCTAGAAGCAGAATTGCTGG + Intergenic
1051441309 9:17086227-17086249 GTTTTCAGAATCCGAATTGTAGG + Intergenic
1051774206 9:20617002-20617024 GCACTTAAAAGCTGAATTGTTGG - Intronic
1051793313 9:20833970-20833992 GTATCTAGAAGTGGAATTGCTGG - Intronic
1053078223 9:35153084-35153106 GTTTTCAGAAGAAGAATAGTTGG + Intergenic
1053119295 9:35533970-35533992 ATACCTAGAAGCAGAATTGCTGG + Intronic
1053588229 9:39482865-39482887 GTATCTAGAAGTGGAATTATTGG - Intergenic
1053728922 9:41032778-41032800 GTATTCAGAAGCAGAATTATTGG - Intergenic
1054578075 9:66882429-66882451 GTATCTAGAAGTGGAATTATTGG + Intronic
1054699590 9:68399305-68399327 GTATTCAGAAGCAGAATTATTGG + Intronic
1054729668 9:68688421-68688443 CTATCTAGAAGTAGAATTGCAGG - Intergenic
1056145715 9:83727015-83727037 ATACTTAGAAGTAGAATTGCTGG - Intergenic
1056183099 9:84104771-84104793 GTAATAAGAAACAGAATTGAGGG + Intergenic
1056242642 9:84664045-84664067 GTATATAGAAGTAGAATGGTTGG + Intergenic
1057414809 9:94851788-94851810 GGATTGAGAAGCAGTATTCTAGG - Intronic
1057882869 9:98806696-98806718 GTATTTTGAAGAAGAATTACAGG - Intergenic
1058215719 9:102231111-102231133 TTATATACAAGGAGAATTGTGGG - Intergenic
1058555433 9:106161768-106161790 AGATTTAGAAGCAGAAAAGTAGG + Intergenic
1058880503 9:109281878-109281900 TTACCTAGAAGTAGAATTGTTGG - Intronic
1059631293 9:116125593-116125615 GAATTTTTAAGCAGATTTGTAGG - Intergenic
1059788153 9:117609714-117609736 GTATCTAGAAATAGAATTGTTGG - Intergenic
1060319671 9:122545731-122545753 GAATATAGAAGTAGAATTCTGGG - Intergenic
1061336080 9:129937223-129937245 ATTTTCAGAAGCAGAATTTTTGG - Intronic
1062256803 9:135627677-135627699 ATATCTAGAGGTAGAATTGTTGG + Intronic
1185588410 X:1257565-1257587 CTGTGTAGAAGCAGAATTGGTGG - Intergenic
1186852626 X:13595662-13595684 ATATTTAAAAGTGGAATTGTTGG + Intronic
1186881982 X:13875504-13875526 GTAGCTAGAAGTGGAATTGTTGG - Intronic
1188183115 X:27080320-27080342 GTATTTATATGCATTATTGTAGG - Intergenic
1189621868 X:42849347-42849369 GTATGTAGGAGCAGCATTGCTGG - Intergenic
1189673160 X:43433712-43433734 ATATTTAGAAGTAGGATTGCTGG - Intergenic
1189887023 X:45557668-45557690 ATACCTAGGAGCAGAATTGTGGG + Intergenic
1192597323 X:72425062-72425084 ATATCTAGAAGTAGATTTGTGGG + Intronic
1192632615 X:72789150-72789172 GTGTGAAGAGGCAGAATTGTGGG + Intronic
1192649094 X:72931651-72931673 GTGTGAAGAGGCAGAATTGTGGG - Intronic
1192866714 X:75141695-75141717 TTTCTTAGAAGTAGAATTGTTGG + Intronic
1193110364 X:77723307-77723329 ATATCTAGAAGTAGAATTGTTGG - Intronic
1193428946 X:81376497-81376519 ATATTCAGAAGCAGAACTTTTGG - Intergenic
1194305998 X:92249002-92249024 GTATTTAAAAGGAGAATTACTGG - Intronic
1194931484 X:99893086-99893108 GTACTCAGAAGTAGGATTGTTGG - Intergenic
1195438528 X:104874179-104874201 TGATTTAGAAGCAGAGTTGGGGG - Intronic
1195467111 X:105191616-105191638 GTATTTAAAAGAACAATTGCAGG - Intronic
1195895467 X:109741875-109741897 ATACTTAGGAGTAGAATTGTTGG - Intergenic
1195935482 X:110121697-110121719 GTACCTAGAAGTAGAATTGCTGG + Intronic
1198091010 X:133329996-133330018 GCATTTAGTAGCAGAACTGGAGG - Intronic
1198446526 X:136722789-136722811 TTCTTTAGGAGCAGAATTGCTGG - Intronic
1198627783 X:138597889-138597911 GTATTTGGAAGGAGGATTGATGG + Intergenic
1199312281 X:146335102-146335124 TAATTTAGAACCAAAATTGTTGG + Intergenic
1199394517 X:147319225-147319247 ATATCTAGAAGTAGAATTGCTGG + Intergenic
1199506855 X:148572388-148572410 ATACTTAGAAGCGTAATTGTTGG - Intronic
1200052331 X:153441026-153441048 GTATCTAGGAGGGGAATTGTTGG + Intergenic
1202140967 Y:21721791-21721813 GCATTTAGAAGTAGAATTTAAGG - Intergenic
1202145898 Y:21782007-21782029 GCATTTAGAAGTAGAATTTAAGG + Intergenic
1202217299 Y:22505052-22505074 TTATTTAGAAACAGCTTTGTTGG + Intronic