ID: 1093220126

View in Genome Browser
Species Human (GRCh38)
Location 12:16410852-16410874
Sequence TGGAACATCTTGGGAAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 374}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093220126_1093220131 17 Left 1093220126 12:16410852-16410874 CCATTTTTTCCCAAGATGTTCCA 0: 1
1: 0
2: 3
3: 35
4: 374
Right 1093220131 12:16410892-16410914 GCTTTTGTACCCTGCCAGGCTGG 0: 1
1: 0
2: 1
3: 14
4: 112
1093220126_1093220130 13 Left 1093220126 12:16410852-16410874 CCATTTTTTCCCAAGATGTTCCA 0: 1
1: 0
2: 3
3: 35
4: 374
Right 1093220130 12:16410888-16410910 TCTTGCTTTTGTACCCTGCCAGG 0: 1
1: 0
2: 0
3: 40
4: 855

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093220126 Original CRISPR TGGAACATCTTGGGAAAAAA TGG (reversed) Intronic
903450515 1:23450912-23450934 TGGGACATCATGGGGAAAGAAGG - Intronic
904847979 1:33435166-33435188 TGGGACAGCTCGAGAAAAAATGG - Intergenic
904876364 1:33657616-33657638 TGGGTCATCTTGGGTAATAAAGG - Intronic
905127318 1:35724802-35724824 TGGTTCATCTTGGGAAAGGAAGG + Intronic
905925519 1:41746799-41746821 TGGAAGTTCTTGGGAATTAATGG + Intronic
907064404 1:51466033-51466055 TAAAATATCTGGGGAAAAAAAGG + Intronic
908061054 1:60349657-60349679 TGGAACATGTTAGGAAAAGATGG + Intergenic
909125805 1:71668019-71668041 TTGAGTATCTTGGCAAAAAAGGG - Intronic
909285368 1:73809721-73809743 TGGAATAGCTTCTGAAAAAATGG + Intergenic
909925249 1:81430746-81430768 TGAATCAGTTTGGGAAAAAAAGG - Intronic
910211950 1:84802539-84802561 TGTAAAATCATGGAAAAAAATGG - Intergenic
910448041 1:87318728-87318750 TGGAACATGCTAGGAAGAAAAGG - Intergenic
911736353 1:101340789-101340811 TGAAATATCTAGGCAAAAAATGG + Intergenic
913492489 1:119394009-119394031 TGGAACATTTGGGGAACACAGGG - Exonic
913579478 1:120211698-120211720 TGGTAGAACTTGGGCAAAAATGG + Intergenic
913628695 1:120686690-120686712 TGGTAGAACTTGGGCAAAAATGG - Intergenic
914561411 1:148823125-148823147 TGGTAGAACTTGGGCAAAAATGG + Intronic
914611424 1:149307083-149307105 TGGTAGAACTTGGGCAAAAATGG - Intergenic
914703881 1:150155976-150155998 TAGATCATCTTGGGAAACAGAGG - Intronic
914927914 1:151905303-151905325 TGGAATTTATTGGGCAAAAAAGG - Intronic
915800915 1:158792517-158792539 TTCTAAATCTTGGGAAAAAAAGG - Intergenic
917318453 1:173753974-173753996 TGGGACATGCTGGGGAAAAATGG - Intronic
917909412 1:179626752-179626774 AAGAAAATCTTAGGAAAAAAAGG + Intronic
917961878 1:180152110-180152132 TGGAACTTCCTGGGATGAAAAGG - Intergenic
918369456 1:183844692-183844714 TGGAACTTCTGGGGAACAGATGG + Intronic
919104064 1:193127439-193127461 TGGGACTACTTGGGAAAATAAGG + Intronic
919744956 1:201003000-201003022 AGGAACAGAGTGGGAAAAAATGG - Intronic
921494818 1:215826447-215826469 GGGAACATATTTGGATAAAATGG + Intronic
921535697 1:216346286-216346308 TGGGACTCCTTGGGAAAAAAAGG + Intronic
921752198 1:218808511-218808533 TGGAACATATTTGGAACATAAGG - Intergenic
921830623 1:219724261-219724283 AGCACCATCTTGGGAAAAGATGG + Intronic
921956459 1:220989528-220989550 TGGAACAGTTTGAGAAAAATTGG + Intergenic
922593132 1:226793877-226793899 TGGAAGATTTTTGGAAAAAAGGG - Intergenic
922759621 1:228119241-228119263 TGGAGCTCCTTGGGAAAAACAGG - Intergenic
923869871 1:237980053-237980075 TAGAAACTCTAGGGAAAAAATGG + Intergenic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924808620 1:247381721-247381743 TGGGACTTCTTGGGAAAAACAGG - Intergenic
924904498 1:248437496-248437518 GGGAATATCTTGAGAAAACAGGG - Intergenic
1063978370 10:11434792-11434814 TGGAATTTATTGGGAGAAAACGG + Intergenic
1064002244 10:11673328-11673350 TGGGGCATATTGGGAAGAAAGGG - Intergenic
1064334176 10:14423432-14423454 TGGAATTTATTGGGCAAAAAGGG - Intronic
1065995900 10:31059211-31059233 TGGAAAAGCTTTGGATAAAATGG + Intergenic
1066739957 10:38510861-38510883 TGGAATATAATGGAAAAAAATGG + Intergenic
1066778237 10:38905484-38905506 TGGAACAGACTGGAAAAAAATGG + Intergenic
1068648019 10:59491464-59491486 TGGAATATCTTGAGAATAATTGG + Intergenic
1068713235 10:60156653-60156675 TGGTAGATTTTGGGAAAATAAGG - Intronic
1069269715 10:66510943-66510965 TGGAATAGTTTGAGAAAAAATGG + Intronic
1069917687 10:71797503-71797525 TGGAACAGATTGAGAAAAAATGG + Intronic
1070388662 10:75949857-75949879 CGCAACATCTTGGGGCAAAATGG - Intronic
1070553148 10:77507206-77507228 TGGAACACCATGGGAAAATGAGG + Intronic
1072084983 10:92070020-92070042 TGGGACACATTTGGAAAAAAAGG + Intronic
1072532764 10:96335197-96335219 AGGAACACCTTGGGAAAGGAGGG - Intronic
1073016256 10:100401979-100402001 TGGAACAGCTAAGGAAAAAGGGG + Intergenic
1074165132 10:110868450-110868472 TGGGGTATCTTGAGAAAAAAAGG + Intergenic
1074580937 10:114718730-114718752 TGGAAGGTCTTGGGCAAAAATGG - Intergenic
1075135400 10:119780687-119780709 TGGAAAATTTTTGGAAAAGATGG + Intronic
1075488031 10:122842684-122842706 TAGATCAACCTGGGAAAAAAAGG + Intronic
1075591004 10:123691666-123691688 GGGAGCATCATGGGAAAAAGAGG + Exonic
1077460726 11:2708051-2708073 TGGGAAATCTTGGGAAACAGGGG - Intronic
1077957595 11:7037737-7037759 TGGAAGATATTAGTAAAAAATGG + Intronic
1078035457 11:7800015-7800037 TAGAAAATCTGGGAAAAAAATGG + Intergenic
1078189353 11:9078674-9078696 GAGAACATCATGGGAAAATATGG - Intronic
1080058414 11:27931643-27931665 TGGGACACCCTGGGAAAAACAGG - Intergenic
1080107267 11:28524106-28524128 AGTAACATCTTGGTAAAAAGTGG - Intergenic
1080240385 11:30120878-30120900 GAGAACATCTGGGGAAAAAGAGG - Intergenic
1080379899 11:31757797-31757819 GGAAACATCTTGGTAAAAAATGG + Intronic
1080669655 11:34364256-34364278 TGGTACATCTGGGGGAGAAATGG + Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1080950977 11:37032469-37032491 TGGAATATTTTCAGAAAAAATGG + Intergenic
1081589785 11:44413699-44413721 TGGAAAATATTTGGGAAAAAAGG + Intergenic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083808619 11:65089621-65089643 AAGAACATCTTGGGAGAGAATGG - Intronic
1084041990 11:66547678-66547700 TGGGGTATCTTGGGAAAGAATGG - Intronic
1084803302 11:71561003-71561025 TGGCAAAGCTTGGGAGAAAAGGG - Intronic
1086303185 11:85452214-85452236 ACAAACATCTTGGGAAAAACAGG + Intronic
1086401418 11:86463766-86463788 TGGACCATAATGGGGAAAAAAGG + Intronic
1087337273 11:96860444-96860466 TAGAAAATCTGGGGGAAAAAAGG - Intergenic
1087462843 11:98466974-98466996 TGGAATTTATTGGGAAAAAAGGG - Intergenic
1088282609 11:108150798-108150820 TGAAAATTCTGGGGAAAAAATGG - Intergenic
1088673835 11:112171090-112171112 TTGAAAATATTTGGAAAAAAAGG + Intronic
1089280403 11:117370360-117370382 TGGAACATCATGTGACAGAAAGG - Intronic
1090371308 11:126255395-126255417 TGGCAGATGTTGGGAAAGAATGG - Intronic
1090889087 11:130907138-130907160 TGGAACACAAGGGGAAAAAATGG - Intronic
1092332037 12:7593800-7593822 TGGAGAACCTTGGGAGAAAAGGG - Intergenic
1092720493 12:11435929-11435951 TGGAATTTATTGGGCAAAAAGGG + Intronic
1093115788 12:15209174-15209196 AGGAACATAAGGGGAAAAAATGG + Intronic
1093220126 12:16410852-16410874 TGGAACATCTTGGGAAAAAATGG - Intronic
1093723399 12:22473457-22473479 TGGAACGTTTTGGGGAATAATGG - Intronic
1093922026 12:24869435-24869457 TGGAACTTATTGGGAAAAAAGGG - Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1095353019 12:41237173-41237195 AGGCACTTCTTGGGAAAAATGGG + Intronic
1095610823 12:44125464-44125486 TAGAAAATCTAGGAAAAAAATGG - Intronic
1095751396 12:45715982-45716004 TGGCACATTTTGGGAAATACTGG + Intergenic
1097360580 12:58654819-58654841 GGGAACATCTTGGGAAAGCTTGG - Intronic
1097415731 12:59313899-59313921 TTGAAAACCTAGGGAAAAAAAGG + Intergenic
1097806124 12:63966941-63966963 TGGAAATTCTTAGGAAAAAAAGG - Intronic
1098268967 12:68751687-68751709 TAAAAGATCTTGGGAAAATAAGG - Intronic
1099001739 12:77186071-77186093 TGGAACAGCTGGGGACACAAAGG - Intergenic
1099478052 12:83132345-83132367 TGGAACATCATGGAAAAACAAGG + Exonic
1100160260 12:91851485-91851507 TAAACAATCTTGGGAAAAAAAGG + Intergenic
1100167721 12:91937138-91937160 TGTGACATCCTTGGAAAAAAAGG - Intergenic
1101905365 12:108820776-108820798 TGGTAATTCTAGGGAAAAAAAGG + Intronic
1102407926 12:112690343-112690365 TGGAAAACCTTGGGACAAAAGGG - Intronic
1102803221 12:115755777-115755799 TGGAACATCTAAAGAGAAAATGG + Intergenic
1102950336 12:117026881-117026903 CGGAAAATCTTGGAACAAAATGG - Intronic
1105793341 13:23824968-23824990 TGGAATATTTTTAGAAAAAATGG - Intronic
1105996696 13:25679266-25679288 TGGAACATCCTGATAAAAAATGG + Intronic
1106401311 13:29433973-29433995 TGGTTTAGCTTGGGAAAAAATGG + Intronic
1106993752 13:35456265-35456287 ACGAACAGCTTGGGAAGAAAGGG - Intronic
1107311525 13:39083363-39083385 TGGGACTTCTTGGGAAAAACAGG + Intergenic
1107341161 13:39407890-39407912 TGGATTATCTTGGAAAGAAACGG + Intronic
1107723260 13:43272024-43272046 TAGCACATTTTGGGAATAAAAGG - Intronic
1108066644 13:46584570-46584592 TGCATCATCATGGGAAAAGAAGG - Intronic
1108609578 13:52070968-52070990 TGGAATAACTTGTGAAAGAAAGG + Intronic
1108703451 13:52963600-52963622 AGGAACATGTTGAGAAAAGATGG - Intergenic
1110094458 13:71499048-71499070 TGAAATTTCTTGGAAAAAAATGG + Intronic
1110907801 13:80915117-80915139 GCTAACATTTTGGGAAAAAAAGG + Intergenic
1111780902 13:92722421-92722443 TGGAACCTATTGGCAGAAAAAGG + Intronic
1112106485 13:96245895-96245917 GGGAACATCCTGGGATAATAGGG + Intronic
1112290222 13:98139810-98139832 TGCCACAGCTTGGGATAAAAGGG + Intergenic
1112313170 13:98337819-98337841 CTGAACATCTTTGGAAATAATGG - Intronic
1112851112 13:103707660-103707682 TTGAATCACTTGGGAAAAAATGG - Intergenic
1115035555 14:28852538-28852560 GGGAACATCATGGGAAAAATGGG - Intergenic
1117056800 14:51920474-51920496 TTGAAAATATTTGGAAAAAATGG - Intronic
1119268802 14:73282803-73282825 CTGAACATCTTGGCACAAAAAGG - Intronic
1119276275 14:73359533-73359555 AGGAACATCTTGATGAAAAAGGG + Intronic
1119495975 14:75079661-75079683 TGGAACATCTCTTGAAAAACTGG + Exonic
1120113437 14:80585032-80585054 TGAAAGATCTTTGGTAAAAAGGG + Intronic
1120199627 14:81522927-81522949 TTGAAAATATTTGGAAAAAATGG - Intronic
1120296065 14:82642693-82642715 CGGAACTTCTTGGGTGAAAAGGG - Intergenic
1120851186 14:89173211-89173233 TGCAACATCTTTAGTAAAAAGGG + Intronic
1121159044 14:91717693-91717715 TGTAAAATCTTGGGAAAAGTAGG - Intronic
1121358549 14:93234636-93234658 TGGGACAACTTGAGAAAAGAGGG - Intergenic
1122431459 14:101650313-101650335 TGGAACATCGGGGGGAGAAAAGG + Intergenic
1122523748 14:102364782-102364804 TGGAACTTAGTGGGAAGAAAAGG + Intronic
1124599462 15:31120285-31120307 TGGAACTTATTGGGATAAATAGG + Intronic
1125098879 15:35887119-35887141 TAGAACATTTTGGGTTAAAATGG + Intergenic
1126440954 15:48687894-48687916 TGGAAAATCTAGGGAAAAAATGG + Intergenic
1127000641 15:54500379-54500401 AAGAAAATCTTGGGAAAAATGGG - Intronic
1127360271 15:58238919-58238941 TGGCACATCAGGGTAAAAAATGG - Intronic
1129191830 15:73941951-73941973 TGGCACATCCTGGGGAACAAGGG + Intronic
1130560903 15:84958228-84958250 AGGAACATCTCGGGAAAAGAGGG - Intergenic
1131164349 15:90131481-90131503 TGGTACATCCTGTGACAAAATGG - Intergenic
1131747509 15:95464903-95464925 TGGTATTTCTTGAGAAAAAAAGG - Intergenic
1133180207 16:4048679-4048701 TGGCAGCTCTTGGGAAAGAAGGG - Intronic
1133499227 16:6349781-6349803 TGGAAAACCATGGGGAAAAATGG - Intronic
1134914189 16:18055914-18055936 TGTAACATCTTGGAAAATAAAGG - Intergenic
1137320630 16:47377961-47377983 TGGAAAGTCTTGGGGAAAGAAGG + Intronic
1137494808 16:48961525-48961547 TGGAAGATCTTGGCCAAAAGGGG - Intergenic
1137833056 16:51562604-51562626 TGGAAGCTCTTGGAGAAAAATGG + Intergenic
1138015504 16:53424816-53424838 TGGGACACCTTGGGAAAAACAGG - Intergenic
1139205738 16:65026711-65026733 GAGAACATCTGGGGAAAAATGGG - Intronic
1140348505 16:74238336-74238358 GGGAAGATCTTGGAAATAAAAGG + Intergenic
1140862472 16:79030411-79030433 GAGAACACTTTGGGAAAAAAGGG - Intronic
1140895612 16:79321921-79321943 TTGAACATCCTGTTAAAAAAAGG + Intergenic
1141870750 16:86783926-86783948 TGGAACTTCTTAGTAAACAAAGG + Intergenic
1145405294 17:22585055-22585077 TGGGATTTATTGGGAAAAAAGGG + Intergenic
1146966107 17:37031494-37031516 TGGAACATCTGGGTACAAAGTGG - Intronic
1147574623 17:41591827-41591849 TGGAACATGTGTGGAAAAACTGG - Intergenic
1148255369 17:46126558-46126580 TGGAATATTTTGGCAAATAAAGG + Intronic
1148575612 17:48708787-48708809 TGGAACATCATGGCACAGAAAGG + Intergenic
1149102325 17:52921867-52921889 TGGAATTTATTGGGAAAAAAAGG + Intergenic
1150028968 17:61711474-61711496 TGGGATTTCTAGGGAAAAAAGGG + Intronic
1151450277 17:74194469-74194491 CGCAACATCTTTGGAAAAAGAGG - Intergenic
1203199663 17_KI270729v1_random:264097-264119 TGGAATAGATTGGAAAAAAATGG + Intergenic
1203209258 17_KI270730v1_random:64806-64828 TGGAATAGATTGGAAAAAAATGG + Intergenic
1153132541 18:1872690-1872712 TGGAACCTATTGGTAAAATATGG + Intergenic
1153677509 18:7468556-7468578 TGAAACCTCCTGGGAAAAAATGG - Intergenic
1154365352 18:13703017-13703039 TGGGACCCCTTGGGAAAAACAGG + Intronic
1155455764 18:26011069-26011091 AGCAAGATCTTGGGAAAGAATGG + Intergenic
1155594322 18:27467153-27467175 GGAAAAATCTTGGGAAAAAAAGG + Intergenic
1156160775 18:34355419-34355441 TGGAGGTTCGTGGGAAAAAATGG + Intergenic
1156177751 18:34566817-34566839 TGAAAGATCTTGAGAATAAAAGG + Intronic
1158661361 18:59391241-59391263 TTGAAGATCTTAGGAAGAAAAGG - Intergenic
1158687537 18:59628356-59628378 TGGATTCTCTTGGGACAAAATGG + Intronic
1158803219 18:60937878-60937900 TGGAACATTTTGGGGGAAAGGGG + Intergenic
1159554323 18:69929389-69929411 TGGAGCATATAGGGAGAAAAAGG - Intronic
1160075551 18:75671833-75671855 TGGAATATTTTTTGAAAAAAAGG - Intergenic
1161092078 19:2366064-2366086 TGAAACTGCTTGGAAAAAAAGGG + Intergenic
1163491911 19:17621848-17621870 GGGAACCTCTTGAGAAAACATGG - Exonic
1164785559 19:30927665-30927687 AGGAACAGCTTGGGGATAAAGGG - Intergenic
1165990748 19:39811721-39811743 TGGAACATCTAAAGAAAAAAAGG - Intergenic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166900910 19:46062081-46062103 TGGAACTCCTTGGGAAAAACAGG - Intronic
1167793019 19:51692415-51692437 AGGAACATTTGGGGAGAAAAGGG + Intergenic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
925272826 2:2626405-2626427 TGGAAGATCTTGTGCAAAACTGG + Intergenic
925322943 2:2990843-2990865 TGGAACATCTTGGACAACATTGG + Intergenic
925323525 2:2996948-2996970 TAAAACATCTGGGGAAAAAAAGG + Intergenic
926581880 2:14639600-14639622 TTGAATAAGTTGGGAAAAAAAGG + Exonic
926798079 2:16635243-16635265 AGGAACATGTTGGGAAAAGTAGG - Intronic
929660262 2:43777313-43777335 TGAAATATCTGGGGAAAATATGG + Intronic
930316113 2:49798975-49798997 TGGAACATATTGGAGAAAATAGG + Intergenic
930860498 2:56066787-56066809 TGGAATAGATTGAGAAAAAATGG + Intergenic
930981691 2:57533503-57533525 TGGAAAATATAGGGAACAAAAGG + Intergenic
931034892 2:58228878-58228900 TGAAATAGCATGGGAAAAAATGG - Intronic
931604594 2:64040103-64040125 AGGAAGGTCTTGAGAAAAAATGG + Intergenic
931628797 2:64281243-64281265 TAGAAAATATTTGGAAAAAAAGG + Intergenic
934066410 2:88345989-88346011 GAGAACATCTTGGGGAAAAGGGG - Intergenic
934909581 2:98238883-98238905 TGGAAATTTTAGGGAAAAAAAGG + Intronic
935338099 2:102035327-102035349 TGGAATTTATTGGGCAAAAAGGG - Intergenic
935724479 2:106011080-106011102 TGGGATTTATTGGGAAAAAAGGG - Intergenic
939398898 2:141666363-141666385 TGGAACAGCCAGGCAAAAAATGG - Intronic
941103470 2:161324396-161324418 TAGACCAACTTGGGAAAAATGGG + Intronic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
942923348 2:181403728-181403750 TGGAAGTTCTGGGGAAAAGAAGG + Intergenic
945913479 2:215677268-215677290 TGGGCCTTTTTGGGAAAAAAAGG - Intergenic
945968427 2:216212662-216212684 TGGCACATCTTGGCTAAAAGGGG - Intergenic
945968604 2:216214752-216214774 TGGCACATCTTGGCTAAAAGGGG - Intergenic
946964851 2:225026826-225026848 TGGAACAATTTGAGGAAAAATGG - Intronic
948024635 2:234767316-234767338 TAGAAAATCCTGGGAAAAGATGG - Intergenic
1170214917 20:13881339-13881361 TAGAACATCCTGAGAAAAGATGG + Intronic
1170296731 20:14835124-14835146 TGGCACAGTTTTGGAAAAAAAGG - Intronic
1170575164 20:17657151-17657173 TGGAACATCATGTTAAAGAAAGG + Intronic
1171193245 20:23176666-23176688 TTGAAGATATTGTGAAAAAATGG - Intergenic
1171399978 20:24866744-24866766 TGATAAATCTGGGGAAAAAAAGG + Intergenic
1171442156 20:25173829-25173851 TGGAACTCCTTGAGAAAAATAGG - Intergenic
1173098664 20:40062795-40062817 TGGAACATTTTTGGAACAATTGG + Intergenic
1173907810 20:46641580-46641602 TGGAAGATCTGGGGCAAGAATGG + Intronic
1174703514 20:52633410-52633432 TGGCATCTCCTGGGAAAAAAGGG + Intergenic
1174717382 20:52774286-52774308 TGGATCCTCTTGGCAAAGAAGGG + Intergenic
1174791324 20:53481111-53481133 TAGAACAGATTGAGAAAAAAAGG - Intronic
1176084180 20:63288578-63288600 TGGAACACCCTGGAAGAAAAAGG + Exonic
1176754233 21:10713900-10713922 TGGAATGTATTGGGAAAGAATGG - Intergenic
1178169658 21:30026036-30026058 TGGAACTTTTTGGTCAAAAAGGG + Intergenic
1178417621 21:32416653-32416675 TTGAACTTCTTGGAGAAAAAAGG - Intronic
1179094961 21:38305662-38305684 TGTAATATATGGGGAAAAAAAGG - Exonic
1179274701 21:39881630-39881652 TGGGCCATTTTAGGAAAAAACGG - Intronic
1179470784 21:41608802-41608824 TGTAATATACTGGGAAAAAAAGG + Intergenic
1180391799 22:12290670-12290692 TGGAACATGGTGGGAAGAACCGG + Intergenic
1180938721 22:19642907-19642929 GGGAACATCTTGGAACAAGATGG + Intergenic
949589632 3:5480587-5480609 AGGCAAATCTTAGGAAAAAATGG + Intergenic
949623521 3:5843717-5843739 TGGAAGAATTTGGGAAAAAAAGG - Intergenic
949830367 3:8208074-8208096 TGGAACATCTCAGGAAGTAAGGG - Intergenic
951945423 3:28130554-28130576 TGGAACATTTTGGTAAATAGTGG + Intergenic
952238354 3:31503895-31503917 TGGCATATCTTAGCAAAAAAAGG - Intergenic
954881242 3:53837390-53837412 TGGATCCTCTTGGTAAAAAGGGG + Intronic
955037509 3:55283330-55283352 TGGAACGTATTGGGCGAAAAGGG - Intergenic
955249618 3:57266247-57266269 TGGAACATTTTGGGTAAGATTGG + Intronic
955346629 3:58166461-58166483 TGAAACAGCTTGTTAAAAAATGG + Intronic
955529711 3:59860431-59860453 TGGAACTTGTAGGGAAAAGAAGG + Intronic
956334299 3:68146113-68146135 TGGAAGAGCTTGAGAAAAACTGG + Intronic
957315121 3:78566876-78566898 AGGAACATTTGGAGAAAAAAAGG + Intergenic
958548399 3:95587425-95587447 TGGAAAATATTGGGAAGAAAAGG - Intergenic
959798470 3:110461295-110461317 TGGATCACCTTGGGAGAGAAAGG - Intergenic
960305799 3:116059509-116059531 TGGAAAATGTTGGCAGAAAAAGG - Intronic
960594436 3:119395424-119395446 TGGGACAGCTGGGGAAAACATGG - Intronic
960781681 3:121326253-121326275 AACCACATCTTGGGAAAAAAGGG + Intronic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
961841572 3:129718035-129718057 TGAAACAATTTGGGAAAAAATGG + Intronic
963609198 3:147443814-147443836 TGGAACAGGTTGGGAATGAAAGG - Intronic
963763385 3:149308081-149308103 TGACACACCTTGGGCAAAAAGGG - Intergenic
963843121 3:150128418-150128440 TGGAACCTTTTGGGAAAAGAAGG + Intergenic
963847989 3:150179417-150179439 AGGAACATTAAGGGAAAAAAAGG + Intergenic
964524193 3:157600179-157600201 TGGAATATCCTGGGGAAAGAAGG - Exonic
964596127 3:158431106-158431128 TGGAACAGTTTGGGAAATACTGG + Intronic
965242021 3:166213803-166213825 TGCAACATCTTGAGATAAGAGGG + Intergenic
965500994 3:169456450-169456472 TGGAACCTAGTGGGAAATAAGGG + Intronic
965565598 3:170113475-170113497 TAGAACAGCCTGTGAAAAAACGG - Exonic
966140844 3:176753631-176753653 TGCAACATCTGGGAAAAACATGG + Intergenic
967735239 3:192944925-192944947 TGGAGCATTTTGGTGAAAAATGG + Intergenic
968053811 3:195675591-195675613 AGGCACATCTAGGGAAGAAAAGG + Intergenic
968102080 3:195973563-195973585 AGGCACATCTAGGGAAGAAAAGG - Intergenic
968229951 3:196999645-196999667 TGGAACATGGTGTGAAAAATGGG + Intronic
968491162 4:891387-891409 TGGAACATCCTGGGACAGACAGG - Intronic
970270231 4:14338864-14338886 TAGAATATCTTGGGATAAAAAGG - Intergenic
971091436 4:23350579-23350601 TGGAAAGTCTTGGGAAAACTAGG - Intergenic
971485601 4:27156853-27156875 TGAATCAACTTGGGAATAAAGGG + Intergenic
971998297 4:33995284-33995306 TGGGATTTATTGGGAAAAAAGGG - Intergenic
974413536 4:61573675-61573697 TGGAGCATCTTTGGACAAGAAGG + Intronic
974726432 4:65805033-65805055 TTGAAAATTTTAGGAAAAAATGG - Intergenic
976472360 4:85444618-85444640 TGAATCATCTTGGAAAAGAATGG - Intergenic
977512500 4:97979150-97979172 CGTATCATCTTGGGATAAAAGGG + Intronic
977738175 4:100443839-100443861 TGGCACAGCTTGGTAGAAAAAGG + Intronic
977987321 4:103398638-103398660 GAGAACCTCTTTGGAAAAAATGG - Intergenic
979060393 4:116051891-116051913 TGCAACAACTATGGAAAAAAAGG + Intergenic
979164678 4:117513427-117513449 AGTAACAGCTTGGGAAACAAAGG + Intergenic
979577449 4:122311097-122311119 TAGAATATATTTGGAAAAAAAGG + Intronic
980585047 4:134801913-134801935 TAAACCATTTTGGGAAAAAAAGG + Intergenic
980800352 4:137740483-137740505 AGGAAAATCTTAGGCAAAAAGGG + Intergenic
981362075 4:143858548-143858570 TAGGACTTCTTGGGTAAAAAAGG + Intergenic
981372809 4:143979384-143979406 TAGGACTTCTTGGGTAAAAAAGG + Intergenic
981381897 4:144082622-144082644 TAGGACTTCTTGGGTAAAAAAGG + Intergenic
981774078 4:148344747-148344769 TGAATTATCTTGAGAAAAAACGG + Intronic
982240759 4:153297110-153297132 TGGAACGTCTTGGGAAATGAAGG + Intronic
983121451 4:163890316-163890338 TGGAATATTTTGTGAAATAAAGG - Intronic
985433140 4:189900798-189900820 TGGAACATGGTGGGAAACACTGG - Intergenic
985737278 5:1591513-1591535 AGGCACATCTAGGGAAGAAAAGG - Intergenic
986817225 5:11426028-11426050 GGAAACATCAGGGGAAAAAAAGG - Intronic
987205558 5:15621324-15621346 TAGATTATGTTGGGAAAAAATGG - Intronic
987665926 5:20939553-20939575 TAGCATATCTTGGGTAAAAATGG - Intergenic
988139296 5:27215215-27215237 TGGAAGATCTGGGGCATAAAAGG + Intergenic
989773549 5:45173918-45173940 ACAAACATCTTGGTAAAAAACGG + Intergenic
990411721 5:55547836-55547858 GGTCACATCTTGGGTAAAAATGG + Intergenic
991106427 5:62848406-62848428 TGAAAAATCTAGGAAAAAAATGG - Intergenic
992436866 5:76762839-76762861 TGCAACATCTGGAGAAAAAGAGG - Intergenic
992826120 5:80551965-80551987 TGAAACAACGTGGGGAAAAATGG - Intergenic
993037325 5:82771908-82771930 TGGAAAATGTGGGGAAAAGATGG - Intergenic
993427345 5:87784150-87784172 TGGAACAAATTAGGAAAATAAGG + Intergenic
994357179 5:98806555-98806577 TGGAACAGTTTGAGAAAAATCGG - Intergenic
995409341 5:111836933-111836955 TGTATCATCTTGGGGAAAATGGG + Intronic
996153299 5:120066419-120066441 TGGGAAAGCTTGGGAAAAAATGG - Intergenic
996236035 5:121130367-121130389 AGTAACATATTGAGAAAAAATGG + Intergenic
996499499 5:124201559-124201581 AGGAACATCTTGTGGAAAAGAGG - Intergenic
996630374 5:125624610-125624632 TGGAACAGTTTCGGAAGAAATGG + Intergenic
997723170 5:136097282-136097304 TGTAGCAACTTGGGAAGAAAGGG + Intergenic
998465980 5:142344191-142344213 TTTACCATCTTGGGAAGAAAGGG - Intergenic
999653990 5:153795010-153795032 TGGAACATTTCTGGAAAAGAAGG - Intronic
1000127686 5:158262923-158262945 TGGAACATCAAGTGTAAAAAAGG + Intergenic
1000164987 5:158639728-158639750 TTGAACATTGTAGGAAAAAAGGG - Intergenic
1000368474 5:160512357-160512379 TGGAACCTCTAGAGAAACAAAGG - Intergenic
1000727799 5:164793203-164793225 TGCATCATCTGGGGAAAAAACGG + Intergenic
1001144410 5:169171325-169171347 TGGATGATCCTTGGAAAAAAAGG + Intronic
1001174488 5:169453880-169453902 TGGAAATTATTAGGAAAAAAGGG - Intergenic
1001967818 5:175924813-175924835 TGGAAAATCTTAAGACAAAAAGG - Intronic
1002249629 5:177918989-177919011 TGGAAAATCTTAAGACAAAAGGG + Intergenic
1002261997 5:177999741-177999763 TGGAGCATCTTGGGAAGGCAGGG - Intergenic
1002316124 5:178344685-178344707 TCAAACATATTAGGAAAAAATGG - Intronic
1003001587 6:2340216-2340238 TGGAATAACTTGAGAAAAATTGG - Intergenic
1003353776 6:5345735-5345757 TGGAAAATCTCAGGATAAAATGG - Intronic
1003731571 6:8830355-8830377 TGGAAAATAAGGGGAAAAAAAGG - Intergenic
1004267681 6:14163343-14163365 TGGAAAATCTTGGAGAAAAGTGG + Intergenic
1004658546 6:17688953-17688975 TTTAACATACTGGGAAAAAATGG - Intronic
1005024684 6:21451060-21451082 TTCAACATCTCGGGAAAACATGG + Intergenic
1006276350 6:33007869-33007891 TGGAGCCTCCTGGGAAAGAAAGG + Intronic
1006589597 6:35144469-35144491 TACAACATCTTGGTAGAAAAAGG - Intronic
1008300526 6:49833162-49833184 TGCAACATCTTTCTAAAAAATGG - Intergenic
1009223347 6:61002771-61002793 TGTAATATCTCGGGAAAGAAAGG + Intergenic
1009325331 6:62342113-62342135 TAGAAAATCTAGGAAAAAAAAGG + Intergenic
1009716783 6:67408063-67408085 TGGAACTCCTTGGGAAAAACAGG + Intergenic
1009990765 6:70840437-70840459 TGGCCCTTCTTGGAAAAAAATGG - Intronic
1011987130 6:93462369-93462391 TAGAAAATATTTGGAAAAAATGG + Intergenic
1012123958 6:95403028-95403050 TGTAACCTCCTGGGAAATAAAGG + Intergenic
1012693728 6:102352627-102352649 AGGAATTTATTGGGAAAAAAAGG + Intergenic
1012855980 6:104502288-104502310 TGCAACACCTGGGGAAACAATGG + Intergenic
1013811302 6:114047923-114047945 GGGATCAACTTGGGAAAAGACGG + Intergenic
1014669600 6:124284881-124284903 TGTAGCATCTTAGGATAAAAGGG - Intronic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1015618460 6:135104548-135104570 AGGATGATGTTGGGAAAAAAAGG - Intergenic
1015628989 6:135212019-135212041 AGGGACATCTTTTGAAAAAATGG - Intronic
1015635127 6:135267404-135267426 TGGCTCATCTAGGCAAAAAAAGG - Intergenic
1016543377 6:145192688-145192710 TGGTACATCTTTGGTAAATAAGG - Intergenic
1017076897 6:150626980-150627002 TGGGACATGCTGGGAAAAAGGGG + Intronic
1020350549 7:7214286-7214308 TGGAACTCCTTGGGAAAAACAGG - Intronic
1020689588 7:11338133-11338155 TGGAACATGGTGGCCAAAAAAGG - Intergenic
1021944355 7:25711566-25711588 TGGAAATTTTTGGGAAAAATGGG - Intergenic
1022322365 7:29299023-29299045 TTGAATTTATTGGGAAAAAAGGG + Intronic
1022572065 7:31464506-31464528 TCAAGCATCTTGGGAAAGAAAGG + Intergenic
1022849861 7:34249132-34249154 TGGAGCATCTTAAGATAAAAGGG - Intergenic
1023661253 7:42473199-42473221 TGGAAAGTCTTGGGAAAACCAGG + Intergenic
1024034053 7:45492016-45492038 TGGAATATTTTGAGAAGAAATGG + Intergenic
1024151158 7:46572469-46572491 TCGAACTTCTTGAGATAAAAAGG - Intergenic
1024443474 7:49449257-49449279 TGGAAGATTTTGTGAGAAAATGG + Intergenic
1024906383 7:54386862-54386884 TGGAACATCCTTTGAAAAATAGG + Intergenic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1030814498 7:114018576-114018598 TGTAACAACTTTTGAAAAAAAGG - Intronic
1031360351 7:120842391-120842413 TGGAACCTCTTGGGGAACACAGG + Intronic
1031489492 7:122369456-122369478 TGGAACACCTATGGAAAAGAGGG - Intronic
1031679711 7:124656614-124656636 TGGTACATCTTGCAAAATAATGG - Intergenic
1034113215 7:148558284-148558306 TCCACCATGTTGGGAAAAAAAGG + Intergenic
1039752578 8:40491989-40492011 TCTAACATGGTGGGAAAAAATGG - Intergenic
1040356108 8:46620093-46620115 CGGAACCTCTTGGGAAGACACGG - Intergenic
1040583282 8:48715482-48715504 TGGCACAGCTTGGCAACAAAGGG + Intronic
1040845231 8:51830608-51830630 TGGATTATCATAGGAAAAAAAGG - Intronic
1042782485 8:72507350-72507372 TACTAGATCTTGGGAAAAAAAGG + Intergenic
1043067732 8:75596698-75596720 AGGAAAATATTGGAAAAAAATGG + Intergenic
1043544933 8:81304783-81304805 AGTAACATCTTGTGAAAAACAGG + Intergenic
1044212810 8:89570387-89570409 TGGAAATTCATGGGAAAAATAGG - Intergenic
1045727184 8:105187158-105187180 TCTAGCATCTTTGGAAAAAATGG + Intronic
1046125147 8:109897272-109897294 TGGAACATCTTGAGTTAAAGTGG + Intergenic
1046975543 8:120272027-120272049 TGGAATATATTGTGAAAGAATGG + Intronic
1048162051 8:132030486-132030508 TTGAACCCCTTGGGAAAAAGTGG - Intronic
1048196681 8:132337157-132337179 TGGAACATCCTGGGGCATAAAGG + Intronic
1050385906 9:5090743-5090765 TGGAGTATCTTGGTACAAAAAGG + Exonic
1050401601 9:5262007-5262029 TGGAACTCCTTGGGGAAAAGAGG - Intergenic
1051466358 9:17382423-17382445 GGGAACATCTTGGGAACAAAAGG + Intronic
1052820141 9:33131966-33131988 TTGATCATTTTGGGAAAATATGG - Intronic
1053068766 9:35088272-35088294 TGGCACAGGTTGGGAAACAAGGG + Intergenic
1055288078 9:74752526-74752548 TTCAACCTCTTGAGAAAAAAAGG - Intronic
1055589168 9:77792015-77792037 TAGTACAACTGGGGAAAAAAAGG + Intronic
1055740512 9:79383121-79383143 TTGAACCTCCTGGGAATAAAGGG - Intergenic
1055802498 9:80055060-80055082 TGGAAGAGTTTGGGAAAAATTGG - Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1058767602 9:108197319-108197341 TGGAAGATACAGGGAAAAAAGGG - Intergenic
1059803339 9:117772987-117773009 AGGAAATTCTGGGGAAAAAATGG + Intergenic
1059939822 9:119347725-119347747 AGGAACAGCTTGGGAGAAAGTGG - Intronic
1060067331 9:120514110-120514132 TGCAACATCTGTGCAAAAAAAGG + Intronic
1061905918 9:133697365-133697387 TGGAAGAGTTTGGGAAAAATGGG - Intronic
1203348585 Un_KI270442v1:57495-57517 TGGAATGTATTGGGAAAGAATGG + Intergenic
1203673715 Un_KI270756v1:3571-3593 TGGAACAGACTGGAAAAAAATGG - Intergenic
1186075056 X:5869432-5869454 TGGAAACTCTTGGGGAAAATAGG + Intronic
1186111515 X:6262136-6262158 AGGAAGATCTTGGGAGAAGAAGG - Intergenic
1188518149 X:31009648-31009670 TGGAACTTATTGGGCAAAAAGGG - Intergenic
1189574768 X:42339910-42339932 TGGAACAGTTTTAGAAAAAACGG + Intergenic
1189621329 X:42842552-42842574 TGGAAGAGTTTGTGAAAAAATGG + Intergenic
1189915148 X:45849541-45849563 GGGGACATCTGGGGAAAAAGTGG + Intergenic
1190434156 X:50407050-50407072 TGGAACATATTGGAAACTAAAGG + Intronic
1190964475 X:55285476-55285498 TGGAAAATCTAGAAAAAAAATGG - Intronic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1193438045 X:81503645-81503667 TGGAATAATTTGGGAAAGAATGG - Intergenic
1193728299 X:85070019-85070041 TGCAGCAACTTGGGGAAAAAAGG + Intronic
1193802798 X:85956512-85956534 TGGTTGATCTTAGGAAAAAATGG + Intronic
1194170242 X:90572054-90572076 TGGAATATTTTCGGAAGAAATGG - Intergenic
1194379907 X:93178943-93178965 TGGGACTCCTTGGGAAAAATAGG + Intergenic
1195302379 X:103543281-103543303 TGGAAAATCTTGGTGCAAAAAGG - Intergenic
1196037677 X:111164611-111164633 TTGGACATATAGGGAAAAAAGGG - Intronic
1196394900 X:115248978-115249000 TGGAGCCTCTTGCCAAAAAAAGG + Intergenic
1196474823 X:116069980-116070002 TGTAACTTCTTAGGAAAAAGGGG - Intergenic
1199076808 X:143534686-143534708 TGGGACAACTTGGGAGAAAAGGG - Intergenic
1199780064 X:151050336-151050358 TGGAACATATTGGGGAAGATGGG - Intergenic
1200516489 Y:4149820-4149842 TGGAATATTTTCGGAAGAAATGG - Intergenic
1200785738 Y:7258910-7258932 TGGAATTTATTGGGCAAAAAGGG + Intergenic