ID: 1093225643

View in Genome Browser
Species Human (GRCh38)
Location 12:16479998-16480020
Sequence GTTTCCTTCTAGAAGTGTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3204
Summary {0: 1, 1: 4, 2: 37, 3: 392, 4: 2770}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093225643_1093225646 9 Left 1093225643 12:16479998-16480020 CCATAACACTTCTAGAAGGAAAC 0: 1
1: 4
2: 37
3: 392
4: 2770
Right 1093225646 12:16480030-16480052 AATCTTTATAACATTGGGTTAGG 0: 1
1: 2
2: 56
3: 376
4: 1470
1093225643_1093225645 4 Left 1093225643 12:16479998-16480020 CCATAACACTTCTAGAAGGAAAC 0: 1
1: 4
2: 37
3: 392
4: 2770
Right 1093225645 12:16480025-16480047 GAATAAATCTTTATAACATTGGG 0: 1
1: 1
2: 4
3: 100
4: 613
1093225643_1093225644 3 Left 1093225643 12:16479998-16480020 CCATAACACTTCTAGAAGGAAAC 0: 1
1: 4
2: 37
3: 392
4: 2770
Right 1093225644 12:16480024-16480046 AGAATAAATCTTTATAACATTGG 0: 1
1: 1
2: 8
3: 73
4: 789
1093225643_1093225647 23 Left 1093225643 12:16479998-16480020 CCATAACACTTCTAGAAGGAAAC 0: 1
1: 4
2: 37
3: 392
4: 2770
Right 1093225647 12:16480044-16480066 TGGGTTAGGCAGTGATCCTTTGG 0: 1
1: 0
2: 1
3: 4
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093225643 Original CRISPR GTTTCCTTCTAGAAGTGTTA TGG (reversed) Intronic
Too many off-targets to display for this crispr