ID: 1093230367

View in Genome Browser
Species Human (GRCh38)
Location 12:16536324-16536346
Sequence CTGTGTATGAAAAAACTACG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 70}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093230365_1093230367 6 Left 1093230365 12:16536295-16536317 CCATCTGTCATTGTATTTCATGT 0: 1
1: 0
2: 3
3: 33
4: 370
Right 1093230367 12:16536324-16536346 CTGTGTATGAAAAAACTACGTGG 0: 1
1: 0
2: 3
3: 8
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093230367 Original CRISPR CTGTGTATGAAAAAACTACG TGG Intronic
911700102 1:100942820-100942842 CTGTGTATGAAAAAAGTAAAAGG + Intronic
912428582 1:109615925-109615947 CTGTGTGTGAAACAACTTAGTGG - Exonic
915699808 1:157781150-157781172 CCGTGTATGAAAATACTTCCTGG + Intergenic
918690380 1:187471832-187471854 CTCTGTATGAAAGAAACACGAGG + Intergenic
924297585 1:242604043-242604065 CTGTGTATATAAAAACTAAAAGG - Intergenic
1064714702 10:18164820-18164842 GTGTGTATGTGAAAACTGCGTGG + Intronic
1069937608 10:71929122-71929144 CTGTGTCTAAGAAAACTACTGGG - Intergenic
1071560760 10:86645273-86645295 CTGAGTCTGAAAGAACTACCTGG - Intergenic
1072156530 10:92728953-92728975 CTGTGGATGAAAAAACAAGAAGG - Intergenic
1086139613 11:83481209-83481231 CTATGTATGAAAAAACAATTTGG - Intronic
1093230367 12:16536324-16536346 CTGTGTATGAAAAAACTACGTGG + Intronic
1094640118 12:32266151-32266173 CTATGTATGATAGAACTACAGGG - Intronic
1099057096 12:77856399-77856421 CTGTGTAAGAAAACACTCCTTGG - Intronic
1102832401 12:116015942-116015964 CTGTATTTGAAAAAACTAAGTGG - Intronic
1104732962 12:131118736-131118758 CTGTGTCTGAGAAGACCACGTGG - Intronic
1109929168 13:69190804-69190826 GTGTGTATGTAAAAACAAAGAGG + Intergenic
1112578208 13:100655959-100655981 CAGTGTATGAAAAATCTCCCTGG + Intronic
1113045334 13:106148724-106148746 CTGTGTATGAAAAAGCAGTGTGG - Intergenic
1114818483 14:25987701-25987723 CTGTGAGTGAAAAAACAACTAGG + Intergenic
1116352783 14:43886593-43886615 CTGTGTATGAATAAAGTCAGAGG - Intergenic
1117987434 14:61401372-61401394 CTGTAAGTGAAAAAACTAGGTGG + Intronic
1118717154 14:68568595-68568617 GTGTATATGAAAAAAATACAAGG - Intronic
1121734234 14:96206634-96206656 CTGTGTTAGCAAAAACCACGTGG - Intronic
1128502014 15:68233282-68233304 CAATGTATGAAACACCTACGGGG + Intronic
1131833458 15:96368609-96368631 CTGTGTCTGAAAAACCGAGGTGG - Intergenic
1139393388 16:66620590-66620612 CTGTGTAATAAATAACTCCGAGG - Intronic
1141843998 16:86594496-86594518 CTGTGTGTGGCAAAACTAGGGGG + Intergenic
1143714813 17:8759315-8759337 CTGTGTATAAAAAGACTAAGGGG + Intergenic
1143957459 17:10683221-10683243 TTGTGTATAAAAAAAATAAGTGG - Intronic
1148979868 17:51563201-51563223 CTGTGTCGGATAAAACTAAGAGG + Intergenic
1150945923 17:69745360-69745382 CTGTGGATGAAAAAGCTACCTGG + Intergenic
1153263363 18:3245522-3245544 CTGAGTATCAAAATACTAGGTGG + Intergenic
1158407666 18:57174560-57174582 CTGTGTTTGAAAAAAGTACGGGG + Intergenic
1159001192 18:62976878-62976900 CTGTGCCTGAAAAAATGACGTGG - Intronic
1160700613 19:505206-505228 CAATGTATGTAAAAAGTACGTGG - Exonic
1168456198 19:56510699-56510721 CTGTGTATGGAGAGACTACTTGG + Intronic
930532008 2:52600334-52600356 CTGTGTAAGAAAAAGCTACATGG - Intergenic
930787777 2:55287389-55287411 CCGAGTATGTAAAAACTAAGAGG - Intergenic
931503440 2:62897127-62897149 GTATGTGTGTAAAAACTACGAGG - Intronic
933437510 2:82267108-82267130 CTGTGTATAATAGAACTAAGAGG + Intergenic
934316774 2:91928610-91928632 CTTTATATGAAAAAAATACTTGG + Intergenic
939436083 2:142180036-142180058 CTGAGTAAGAAAAAAATACATGG + Intergenic
939915610 2:148039716-148039738 GTCTATATGAAAATACTACGTGG + Intronic
1169061650 20:2664668-2664690 CCCTGTAAGAAAAAACTACGAGG - Intergenic
1169396177 20:5231526-5231548 ATGTATATGAAAATATTACGAGG + Intergenic
1177603910 21:23354456-23354478 ATGTGTATGAAAAAACTGGGTGG + Intergenic
949973077 3:9427964-9427986 CTGTGTATGAAAAAGCGGTGAGG - Intronic
956802755 3:72777228-72777250 CTGTTTATGAAAACACTACAAGG + Intronic
960219922 3:115094460-115094482 ATGTGTATGTGAAAACTATGTGG - Intronic
960645357 3:119874799-119874821 CTGTGTATTAAATAAATACAGGG - Intronic
962213507 3:133499829-133499851 CTGTTTAGAAACAAACTACGAGG + Intergenic
964688096 3:159419881-159419903 CTGTGCATGCAAAAACTCGGTGG + Intronic
965280079 3:166739588-166739610 CAGTGTATGAAAATACTCCTAGG - Intergenic
968169821 3:196501009-196501031 CTGTGTGTCAAAAAATTGCGGGG - Intronic
971162310 4:24145951-24145973 CTATGTATGAAAATACTCCTGGG - Intergenic
975330434 4:73106577-73106599 CTGTGTATTAAAAAAATACGCGG + Intronic
976575899 4:86670807-86670829 CTGTGTATGAAATAACTAAGAGG + Intronic
979649187 4:123109710-123109732 CTGTGTATAAGTAAACTATGTGG - Intronic
980187367 4:129479098-129479120 CTGAGTATGAAAAAAATATAAGG - Intergenic
985268208 4:188169868-188169890 TTGTGTAATAAAAAACTACTGGG - Intergenic
985878118 5:2616187-2616209 CTGTGTCTGAAAACACTCTGCGG - Intergenic
992195659 5:74336525-74336547 CTGTGTATGAAACAGCTGCCGGG + Intergenic
992955764 5:81906605-81906627 CTGTGCATGAAGAAATCACGTGG + Intergenic
999030772 5:148288536-148288558 GTTTGGATGAATAAACTACGTGG - Intergenic
1001380102 5:171300121-171300143 CTGTGTATGAAGGAACTCAGGGG + Intergenic
1009915064 6:69984667-69984689 CTTTTTGTGAAAAAACTAGGAGG - Intronic
1013347584 6:109277029-109277051 CTGTGTATGAAAATCATAAGTGG - Intergenic
1016743124 6:147549491-147549513 CTGTGCATGAAAAAAGAACAAGG - Intronic
1017311960 6:152984936-152984958 CTCTGCATGGAAAAACTACAAGG - Intergenic
1022358569 7:29638685-29638707 ATGTGTTTGCAAAAACTACTTGG - Intergenic
1023093312 7:36636153-36636175 GTGTGTCTGAAAAAACTGCTCGG - Intronic
1027476783 7:78641724-78641746 CTGTGTATTAGAAAGCTACCTGG - Intronic
1038882824 8:31633730-31633752 ATGTGTCTGAAGAAACTAAGGGG - Intergenic
1039583120 8:38683010-38683032 CTGTGGAGGAAAAAACAAGGCGG + Intergenic
1041636121 8:60146904-60146926 GTGTTTATGAAAAAACTGAGGGG + Intergenic
1043362710 8:79494048-79494070 CAGTGTATGAAAAAGGTACTTGG - Intergenic
1047582195 8:126228314-126228336 TTATGTATGAGAAAACTAAGGGG + Intergenic
1050907125 9:11018440-11018462 CTGAGGATGAAAATACTATGTGG - Intergenic
1053664395 9:40307441-40307463 CTCAGTATGGAAAAGCTACGAGG + Intronic
1054520219 9:66068844-66068866 CTCAGTATGGAAAAGCTACGAGG - Intergenic
1186072703 X:5839547-5839569 CTTTGTATGATAAAACTAAATGG + Intergenic
1189682840 X:43534658-43534680 GAGTGTATGAAAAAGCCACGTGG + Intergenic