ID: 1093233377

View in Genome Browser
Species Human (GRCh38)
Location 12:16576174-16576196
Sequence CTGTGTTATAGAAAGGCTAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 173}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093233377 Original CRISPR CTGTGTTATAGAAAGGCTAC CGG (reversed) Intronic
900767280 1:4513851-4513873 CTGGGTAATAGAAAGTCTGCCGG - Intergenic
902060597 1:13638888-13638910 ATGTGTTATGGGAAGGCTAATGG + Intergenic
902353857 1:15881337-15881359 CTCTGCTTTAGAAAGGCAACTGG + Intronic
904708912 1:32413718-32413740 CGGTGTTATCCAAAGGCTTCTGG + Intergenic
905616587 1:39405025-39405047 CTGTCTTTTGGAAAGTCTACAGG + Intronic
907008390 1:50939374-50939396 CTGGTGTATAGAAATGCTACTGG + Intronic
907682036 1:56573541-56573563 CTGTGTTTTATAAACGCTGCCGG - Intronic
908566721 1:65364453-65364475 CTGAGTTATAGCATTGCTACTGG - Intronic
909154038 1:72048074-72048096 TTGTGAAATAGAAAGGCTATTGG - Intronic
909924511 1:81423364-81423386 CTGTGTTCTAGAAAGTGTCCTGG - Intronic
911797194 1:102090173-102090195 ATCTTTGATAGAAAGGCTACAGG + Intergenic
911834774 1:102603406-102603428 CTGTGTAAAAGCAAGGCAACAGG - Intergenic
913470567 1:119181745-119181767 ATTTTTGATAGAAAGGCTACTGG + Intergenic
916124977 1:161561420-161561442 ATGTGTTATGGGAAGGATACTGG + Intergenic
916134871 1:161642765-161642787 ATGTGTTATGGGAAGGATACTGG + Intronic
919562312 1:199137133-199137155 AAGTGTTAGAGAAAGGCTAAAGG - Intergenic
920045816 1:203131673-203131695 CTGAGTTAGGGAAAGGCTGCTGG + Intronic
920595153 1:207261627-207261649 TTGTTGTATAGAAATGCTACAGG - Intergenic
920982985 1:210855698-210855720 CTCTGCTATAGAAAGGCAGCAGG - Intronic
922196877 1:223366322-223366344 CTGGGTCAGAGAAAGGCCACAGG - Intergenic
922249236 1:223832519-223832541 CTGGGTTATAGGAAGCCTAGTGG - Intronic
1064950665 10:20846069-20846091 CAGTGTTTTAAAAAGGCTAATGG - Intronic
1067011825 10:42721323-42721345 CTGTGTTTTAGCAAGGCCTCTGG + Intergenic
1067311762 10:45120530-45120552 CTGTGTTTTAGCAAGGCCTCTGG - Intergenic
1068706058 10:60076929-60076951 CTGTATCATGGAAAGGCTAAAGG - Intronic
1069234640 10:66055524-66055546 TTGTTATATAGAAATGCTACTGG + Intronic
1071593066 10:86894852-86894874 CTGTGTTATACAAGGGTAACGGG + Intronic
1073350255 10:102814431-102814453 CTGTGTGAGAGCCAGGCTACAGG - Exonic
1073983301 10:109179043-109179065 CTGAGTTAAAGTAAGGCTATAGG - Intergenic
1073991043 10:109262314-109262336 CTGTGTTTTAGAAAAGAGACTGG - Intergenic
1074119026 10:110479580-110479602 CTCAGTTATAGATAGGCCACAGG + Intergenic
1074327641 10:112468184-112468206 CTGGGTTGCAGAAAGGCCACCGG + Intronic
1074331747 10:112519070-112519092 CTGTGTTATAGTGAGGTTATAGG - Intronic
1075282328 10:121149927-121149949 CTAGGGTATAGAAATGCTACTGG + Intergenic
1075833665 10:125433821-125433843 CTATGTTATAGTAAGGCTTCTGG + Intergenic
1076499336 10:130924087-130924109 CTGTGCTGTACAAAGGCCACAGG + Intergenic
1086618707 11:88858072-88858094 TCGTGTTATAGAAAGACTCCAGG - Intronic
1087357970 11:97119382-97119404 CTCTGTTATTGAAAGGTTACTGG - Intergenic
1090292104 11:125554604-125554626 CAGTGTTATCTAAAGGCTTCTGG - Intergenic
1092700329 12:11221875-11221897 TTGGGGTATAGGAAGGCTACTGG - Intergenic
1093233377 12:16576174-16576196 CTGTGTTATAGAAAGGCTACCGG - Intronic
1095162580 12:38935136-38935158 ATTTTTGATAGAAAGGCTACGGG + Intergenic
1095334898 12:41012511-41012533 TGGTGTTATCCAAAGGCTACTGG - Intronic
1095384258 12:41631636-41631658 CTGCTGTATAGAAATGCTACTGG - Intergenic
1095768305 12:45921766-45921788 CTGTGTTATAGTGTGGATACTGG - Exonic
1095914283 12:47460426-47460448 CTGTGATAAAGAAAGGATATAGG + Intergenic
1096883328 12:54691193-54691215 CTGGGTTAGAAAAAAGCTACTGG - Intergenic
1097204686 12:57310553-57310575 CTGGGTTAAAGGAAGGCTGCTGG - Intronic
1097360052 12:58648978-58649000 CTGTGATATACAAAGTCTAAAGG + Intronic
1097756611 12:63414218-63414240 CTGGCATATAGAAAGGCTACTGG + Intergenic
1099301659 12:80902671-80902693 TTGGTGTATAGAAAGGCTACTGG + Intronic
1101365446 12:104065409-104065431 CTGTGGAATAGAAAGGAAACTGG + Intronic
1101746740 12:107547388-107547410 CTGTGTAATAGAAAGTATAATGG - Intronic
1105424592 13:20283663-20283685 CTGTGTTATCCAAAGGCCCCTGG + Intergenic
1107078813 13:36352368-36352390 TTATGTTATAAATAGGCTACTGG + Intronic
1107261184 13:38493623-38493645 AGGTGATATAGAAAGGCTAGAGG + Intergenic
1107349121 13:39495851-39495873 CAGTGTTGTAGAAAGACTTCAGG + Intronic
1107508380 13:41058460-41058482 CTGAGTTGTAGAAGTGCTACTGG - Intronic
1112074022 13:95888548-95888570 ATATGTAATAGAAAGGATACAGG + Intronic
1114198699 14:20503319-20503341 CTGTGATTTACAAAGTCTACTGG - Intergenic
1116104042 14:40476612-40476634 CAGTGTTATCCAAAGGCTTCTGG - Intergenic
1118206924 14:63730934-63730956 CTGTGTTTTAGAAAGATAACTGG + Intergenic
1121365253 14:93303126-93303148 TTCTGTTACAGAAAGACTACTGG + Intronic
1121500271 14:94430334-94430356 TTGTGTTATCGAAAGACCACAGG + Intergenic
1122149435 14:99717044-99717066 CAGTGTTAAAGCAAGGCTGCAGG + Intronic
1127190251 15:56522590-56522612 CTGCTGTATAGAAATGCTACTGG - Intergenic
1129833510 15:78686208-78686230 CGGTGTAATAGAAAGGCCGCTGG - Intronic
1131303185 15:91217904-91217926 TTGTGTTAGAGAAAGTCCACTGG - Intronic
1138647941 16:58438818-58438840 CTGGGATATAGACAGGCCACAGG + Intergenic
1138698964 16:58842876-58842898 CTGTTTTATAGACAGGAAACTGG + Intergenic
1141670161 16:85487534-85487556 CTGTGTTATAGATGGGAAACAGG + Intergenic
1144255149 17:13460342-13460364 CTGTGATATAATAAGGCTACAGG + Intergenic
1147719125 17:42527486-42527508 CTGTGTGATAGGCAGGCAACTGG + Intergenic
1150355975 17:64485047-64485069 GTGAGATATAAAAAGGCTACTGG - Intronic
1153754438 18:8265685-8265707 CTGTGTTATAGAAAGGACAGTGG + Intronic
1158120553 18:54043384-54043406 TTGTGTAATAGAAAGTCTAGTGG - Intergenic
1159174262 18:64813676-64813698 CAGTGTTATCCAAAGGCTTCTGG + Intergenic
1159282992 18:66311029-66311051 CTATGTTTTAGAAAGGAGACTGG - Intergenic
1164736621 19:30545898-30545920 CTGTGTTTTAGAAATGCACCTGG - Intronic
1166973571 19:46588987-46589009 CTGTGTATTAGAAAGTTTACTGG - Intronic
1167866773 19:52335362-52335384 CTGTGTGTTAAAAACGCTACAGG - Intergenic
925044784 2:764587-764609 CTGTGTTAGAAAATGGCTCCAGG - Intergenic
927122677 2:19982482-19982504 CTGATTCATAGAAAGGTTACTGG + Exonic
933306601 2:80608107-80608129 ATTTGTTATAGAAAAGCTGCAGG - Intronic
935048151 2:99500084-99500106 ATTTTTGATAGAAAGGCTACGGG - Intergenic
935522135 2:104120923-104120945 ATGAGTCACAGAAAGGCTACAGG + Intergenic
935748571 2:106210772-106210794 ATTTTTTATAGGAAGGCTACTGG - Intergenic
935935661 2:108180311-108180333 CTGTGTTAAAAAAAAGCTCCAGG - Intergenic
936449578 2:112624105-112624127 CTGTGTTTTAAAAAGCCTTCCGG - Intergenic
936483907 2:112910433-112910455 CTGTGTTATTGACATGCTGCTGG + Intergenic
936731477 2:115386239-115386261 CTGTGTTATAAAAAGAGTATAGG + Intronic
936851466 2:116904045-116904067 CTGTCTTACAGAAATGCTAAAGG - Intergenic
937075953 2:119106764-119106786 CAGTGTTATAGAAAGAGTATGGG - Intergenic
940621654 2:156121087-156121109 CTGTGTTTTAGCAAAGATACTGG + Intergenic
943794542 2:191975841-191975863 CTGTGTTGTAGAAAGGCAGATGG - Intronic
945062321 2:205919902-205919924 CTGGGTTATCCAAAGGCTTCCGG + Intergenic
945720083 2:213408286-213408308 ATTTTTTATAGGAAGGCTACAGG - Intronic
1169072145 20:2739192-2739214 CTGGGTGATGGGAAGGCTACAGG - Intronic
1170437802 20:16348788-16348810 CTGTGTTAAATACAGGCCACAGG + Intronic
1171562923 20:26144151-26144173 GTGTGTTATAGAAGGGCTGGAGG + Intergenic
1172627284 20:36354616-36354638 CTGTTTTTTAAAAAGGCTAGTGG - Intronic
1179111474 21:38449662-38449684 ATCTGTTATAGAAAGGCATCAGG - Intronic
1183138464 22:35913710-35913732 CTATGTCATAGAAAGGCTATGGG + Intronic
953147029 3:40287907-40287929 ATGTGATGTAGAAAGGCTATTGG - Intergenic
955719289 3:61864688-61864710 CTGTGTTATTGGAATGCTCCAGG - Intronic
957845006 3:85720965-85720987 CTGTGTTATATAATAGCTAATGG + Intronic
959672329 3:108993125-108993147 TTATGTTATGGAAAGGATACAGG - Intronic
960956799 3:123038023-123038045 CGGTATTATAGAAGAGCTACAGG - Intergenic
961136684 3:124518315-124518337 CTGTTTTCTATAAGGGCTACGGG + Intronic
962386038 3:134933446-134933468 CTGTGTTGTGGAGAGCCTACTGG + Intronic
963593214 3:147289273-147289295 ATGTGTTATAGAAAGAACACTGG + Intergenic
963915513 3:150855715-150855737 ATTTGTCATAGGAAGGCTACGGG - Intergenic
964169518 3:153753022-153753044 CTGCCTTCTAGAAAGGCAACTGG + Intergenic
964306131 3:155342287-155342309 TTGTGTTATAGAAAAGCTATCGG + Intergenic
964519644 3:157550714-157550736 CTGTCTTACAGAAATGCTAAAGG - Intronic
966127683 3:176599030-176599052 CTGTGATATAGAACTGCTAGAGG + Intergenic
966408922 3:179628836-179628858 CTGTGTTAAATAAAGCCTAGAGG - Intergenic
966576444 3:181507871-181507893 CTGTTTTTTAAAAACGCTACAGG + Intergenic
973304351 4:48628212-48628234 CTGCTTTAAAGAAATGCTACAGG - Intronic
975205481 4:71639933-71639955 ATTTTTTATAGGAAGGCTACGGG - Intergenic
976713129 4:88094510-88094532 GTGTGATGTATAAAGGCTACTGG - Intronic
979788950 4:124754144-124754166 CTGTGTTAGAGCAGGGCTAGAGG + Intergenic
980014843 4:127637262-127637284 CTGTGTTTTAGAAAGCAAACTGG - Intronic
982810015 4:159813523-159813545 CTGAGTTTTAGAAAGGGGACTGG - Intergenic
982893963 4:160892978-160893000 CTGTGTTATATAAAAGAGACTGG + Intergenic
983138867 4:164123142-164123164 TTGGCATATAGAAAGGCTACTGG - Intronic
986589251 5:9351974-9351996 CAGTGTTATAGCAAGGCTAAGGG - Intronic
992238073 5:74732977-74732999 CACTCTTATAGAAAGGCTTCTGG + Intronic
992598582 5:78372139-78372161 CTGTGTTATATACATGCTAACGG + Intronic
993396672 5:87397947-87397969 CTGTGTTCTAAAAACGCTAATGG + Intronic
999700293 5:154221470-154221492 CTGAGTTTTAGAATGGCTCCAGG - Intronic
1002615280 5:180449703-180449725 CTGTATTTAAGAAAGCCTACTGG - Intergenic
1003366039 6:5475914-5475936 CTGAGTTACAGAATGGCTAATGG - Intronic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1010346283 6:74814852-74814874 CTGTTTTCTTGAAAGGCTATGGG - Intergenic
1010715633 6:79226207-79226229 CTGTGTTTGAGAAAGGCTGCAGG + Intronic
1012387088 6:98694763-98694785 CTGTATTATAAAAAGAATACAGG + Intergenic
1012466223 6:99519051-99519073 ATGTGTTAGTGAAAGGCTATTGG - Intronic
1013977610 6:116095080-116095102 ATTTTTGATAGAAAGGCTACGGG - Intergenic
1014008239 6:116446092-116446114 CTTTGTTAAAGATAGACTACTGG + Intergenic
1015966942 6:138703693-138703715 CTGAGTTTTCAAAAGGCTACTGG - Intergenic
1017711152 6:157169345-157169367 CTGTGTTGTAGACAGTGTACGGG + Intronic
1018687326 6:166313916-166313938 ATTTTTGATAGAAAGGCTACTGG - Intergenic
1021127619 7:16871478-16871500 TTGTTGTATAGAAATGCTACTGG - Intronic
1022799895 7:33766307-33766329 CTGTTTTCTAGAAAGGTTTCTGG + Intergenic
1023216241 7:37866106-37866128 CTGTGTATTAGAAAGTGTACTGG + Intronic
1025162150 7:56670505-56670527 ATGTGTTATAAAAAGCCTATGGG - Intergenic
1026602064 7:71785292-71785314 CTGTTTTCTGGAAAGGCTGCAGG - Exonic
1027329068 7:77072286-77072308 CTGTATTACAGAAAAGCAACTGG - Intergenic
1027903444 7:84148937-84148959 CTGTGTTATGGTAAGGTTTCTGG + Intronic
1032666511 7:134042603-134042625 TGGTGTAATAGAAAGGTTACAGG + Intronic
1036941064 8:13052466-13052488 CTGTTTTATTCAAAGCCTACTGG + Intergenic
1041396176 8:57393866-57393888 CTGTGTGATGGAAAGACTATGGG + Intergenic
1041868262 8:62601949-62601971 CTTTATTGTAGAAAAGCTACAGG - Intronic
1042255202 8:66795659-66795681 CTGGGTAAGAGAAATGCTACAGG - Intronic
1042289295 8:67151641-67151663 CAGTGGTACAGAAAGGCTATAGG - Intronic
1042764421 8:72304896-72304918 TTGTTTTATAGAAATGCTACTGG + Intergenic
1042932928 8:74031060-74031082 CCGTGTTATCCAAAGGCTTCTGG + Intergenic
1043241336 8:77938931-77938953 CTATGTTTTAGCAAGGATACTGG - Intergenic
1044952956 8:97451435-97451457 CTGTGTTGTGGGAAGGTTACCGG - Intergenic
1045095714 8:98795718-98795740 CTGGTGTATAGAAATGCTACTGG - Intronic
1046201224 8:110930117-110930139 TTCTGTTATAGAAAGCCTAGAGG + Intergenic
1046995671 8:120519368-120519390 CTGTGTAGTAAAAAGGCTACTGG + Intronic
1048083241 8:131151107-131151129 CTGTGCTATACAAAGGCTTTGGG - Intergenic
1048139432 8:131778809-131778831 CTGTGGTTCAGAAAGGCTAAAGG - Intergenic
1048935031 8:139347947-139347969 CAGAGTTATAGAAAGGCATCAGG + Intergenic
1051591973 9:18785271-18785293 CTGTTTTATAAGAAGGCCACTGG + Intronic
1057945941 9:99328323-99328345 CAGTGTTATTGAAAAGCCACCGG + Intergenic
1058445021 9:105047210-105047232 CTGTTTTACTGAAATGCTACTGG + Intergenic
1058464831 9:105216758-105216780 CTGTGATACAGAAAGGGCACTGG - Intergenic
1060035127 9:120248768-120248790 CTGTCTTATAGAAAGGAAAATGG - Intergenic
1061125810 9:128674945-128674967 CTGTGGTAGAGAAACTCTACCGG + Intergenic
1203626138 Un_KI270750v1:25135-25157 GTGTGTTATAGAAGGGCTGGAGG - Intergenic
1185830638 X:3299578-3299600 TTGTGTGATAGGAAGGCTGCAGG + Intergenic
1189279041 X:39808400-39808422 CTGTGGTTTAGAAAGACTATGGG - Intergenic
1190023120 X:46897328-46897350 CAGTGTTATCCAAAGGCTTCTGG + Intronic
1192669580 X:73125951-73125973 CTTCGTTATAGAAATGCAACAGG - Intergenic
1192754252 X:74029838-74029860 GTGGGATATAGAAATGCTACAGG - Intergenic
1193790732 X:85812872-85812894 CAGTGTTATCCAAAGGCTTCTGG + Intergenic
1194371996 X:93085295-93085317 CTGGCATATAGAAATGCTACTGG + Intergenic
1194379477 X:93176077-93176099 CTGTGTTATCCAAAGGCCCCAGG + Intergenic
1197843006 X:130770207-130770229 CTGTTTTCTAGACAGGCTCCAGG - Intronic
1199317683 X:146400064-146400086 CTGTGTTTTAGCAAGGAGACTGG + Intergenic
1200680041 Y:6199332-6199354 CTGGCATATAGAAATGCTACTGG + Intergenic
1201890819 Y:18942106-18942128 CTATGTTATTGTAAGGCTTCTGG + Intergenic