ID: 1093233974

View in Genome Browser
Species Human (GRCh38)
Location 12:16583703-16583725
Sequence CTGTAGGAATGGATTGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 237}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093233974 Original CRISPR CTGTAGGAATGGATTGAAAA AGG Intronic
900924779 1:5697936-5697958 CTTTAGGAATGGAATGGAATTGG - Intergenic
901345218 1:8534376-8534398 CTGTAGTACTGGATTGAACTTGG + Intronic
901847449 1:11992532-11992554 CTGGAGGTGGGGATTGAAAATGG - Intronic
904124070 1:28223792-28223814 CTGTGGGGTTGGACTGAAAATGG + Intronic
904595382 1:31641357-31641379 CTGTGAGAATGGATTGAAGCAGG - Intronic
907362320 1:53928371-53928393 TTTGAGCAATGGATTGAAAAAGG - Exonic
908003653 1:59706800-59706822 CTGTAGAATTAGATTGACAATGG + Intronic
908028953 1:59979774-59979796 TTGTAGGAACAGATGGAAAATGG + Intergenic
908307046 1:62830468-62830490 CTGGTGGAATGGGTTGCAAATGG + Intronic
909087305 1:71182590-71182612 CTTCAGGAATGCAGTGAAAATGG + Intergenic
910337154 1:86147864-86147886 CAGTAGGAAAGGATTTTAAAAGG - Intronic
910711870 1:90190187-90190209 CTGAAGGAATGGGATGGAAAAGG - Intergenic
911869675 1:103079831-103079853 TGGAATGAATGGATTGAAAAAGG - Intronic
913148632 1:116017598-116017620 TTGTAAGACTGGATTGATAAAGG - Intronic
913707542 1:121441835-121441857 ATGGAGGAAGGGATGGAAAAGGG - Intergenic
914779210 1:150769017-150769039 CTGTAGGAATTTATTCAAACTGG + Intergenic
915909892 1:159908440-159908462 CAGTGAGAATGGGTTGAAAATGG - Intergenic
916588862 1:166170958-166170980 CTAAAGGAGTGGATTGTAAAGGG - Intergenic
916655239 1:166869498-166869520 TTGTGAGAATGGACTGAAAAAGG + Exonic
917040425 1:170800144-170800166 CTGTTGAAAAGGATTGCAAATGG - Intergenic
920449615 1:206049598-206049620 CTGTAAGGATGAATAGAAAAAGG - Intronic
920753199 1:208702361-208702383 GTGGAGGAATTGATAGAAAAGGG + Intergenic
922011201 1:221589876-221589898 CTGTAGGCATGGATTAGAATAGG + Intergenic
922179689 1:223224016-223224038 CTGTAGGATGGGATTGAAAGTGG + Intronic
923731554 1:236555967-236555989 CTCTAGGAATCATTTGAAAATGG - Intronic
924191896 1:241562345-241562367 TTGTGGGAAGGGGTTGAAAAAGG - Intronic
924300291 1:242631171-242631193 CTGAATGAATGATTTGAAAATGG - Intergenic
1063171267 10:3512062-3512084 CTGTAGGATTACATTGGAAAAGG + Intergenic
1063431835 10:5997842-5997864 GTGTAGGAATTGACTGTAAAGGG - Intergenic
1063780757 10:9320614-9320636 CTGTTGGAATGCAGTGAACAAGG - Intergenic
1064001606 10:11668197-11668219 CTGGAAGAAGGGATGGAAAAGGG + Intergenic
1064188596 10:13185660-13185682 ATGAAGGAAAGGATGGAAAATGG + Intronic
1064478374 10:15715960-15715982 CAGTGGGAATGGCCTGAAAATGG - Intronic
1064790854 10:18956577-18956599 ATGTAGAAATGGATAGAAAAGGG - Intergenic
1065310306 10:24409451-24409473 CTGGAGGAAGGGATTACAAATGG + Intronic
1068801016 10:61139701-61139723 CTGCAGGAATTGATTAAAACAGG + Intergenic
1074821731 10:117184618-117184640 CAGCAGGAAGGGATTTAAAATGG - Intergenic
1075298122 10:121296020-121296042 CTTTGTGAATGGATAGAAAATGG + Intergenic
1076147508 10:128135855-128135877 GTATAGGAATAGATTGAAATAGG + Intergenic
1078933056 11:15927922-15927944 CTGTAAGAAGTAATTGAAAAGGG - Intergenic
1079251033 11:18788162-18788184 TTGTAAGAATGGTTAGAAAAAGG - Intronic
1080152134 11:29064628-29064650 CTATTGAAATGGATTGAAAATGG - Intergenic
1081055189 11:38401309-38401331 CTGAAAGAATGGATTGAAATAGG - Intergenic
1081329234 11:41784005-41784027 GTGTAGGAATGTATTTAAGATGG + Intergenic
1082842175 11:57698759-57698781 CTGAACGAATGGATTGCAACTGG - Exonic
1086103113 11:83122211-83122233 CTGGAGAAATGGAATGAAAGAGG - Intergenic
1086844841 11:91735943-91735965 TGGTAGGGATGCATTGAAAAAGG + Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1093163642 12:15779962-15779984 ATGTAAGAATGGTTTGAAACAGG + Intronic
1093233974 12:16583703-16583725 CTGTAGGAATGGATTGAAAAAGG + Intronic
1094829777 12:34294808-34294830 ATGAAGGTCTGGATTGAAAAGGG - Intergenic
1095032269 12:37304982-37305004 CTGTAGGAATTCATTGGAAACGG + Intergenic
1097873740 12:64624189-64624211 CTTTAGGAATGGATTGTAAGTGG - Intronic
1098443641 12:70544370-70544392 CTAGAAGAATGGATTGAAAGGGG - Intronic
1099096793 12:78384098-78384120 CAGTAAGAATGGATAGAAAGTGG - Intergenic
1099492971 12:83308504-83308526 CTGAGGGAATGCAGTGAAAAGGG - Intergenic
1099717152 12:86310559-86310581 CTGTAGGAATGGAGTCAGTAAGG - Intronic
1100111603 12:91250584-91250606 CTATCTGAATGGATTAAAAAGGG - Intergenic
1101088089 12:101256656-101256678 CTGAAGGAAGGGATTTTAAAGGG + Intergenic
1102279394 12:111606985-111607007 ATGCAGGAAGGGATTTAAAATGG + Intergenic
1102715268 12:114965660-114965682 ATGGAGGAATGGGTGGAAAATGG - Intergenic
1106438700 13:29746220-29746242 CTGAAGCAGAGGATTGAAAAGGG + Intergenic
1106921660 13:34570614-34570636 AAGTAGGAATGGATTGAGAAGGG + Intergenic
1107780535 13:43897269-43897291 CTGTAAGAAGGGATTCAATAAGG - Intergenic
1107979608 13:45722051-45722073 TTTTAGGAATGGATTGAAGCTGG - Intergenic
1111908895 13:94287998-94288020 ATGAATGAATGGAATGAAAAGGG - Intronic
1112128461 13:96496150-96496172 ATTTAGGAATGGGATGAAAAAGG - Intronic
1115140615 14:30167239-30167261 CTCTAAGAGTGGATTGAAAATGG - Intronic
1115846006 14:37535626-37535648 CTGTAGGGATGGATTATAAAAGG - Intronic
1115912718 14:38274333-38274355 CAGTAGGAAGAGATGGAAAAAGG + Intergenic
1116890506 14:50263594-50263616 ATGGAGGGATGGATTGTAAATGG + Intronic
1116982147 14:51183080-51183102 CTGTAGGGATGGATACAGAAAGG + Intergenic
1117629497 14:57675374-57675396 CTGGATTAGTGGATTGAAAAAGG + Intronic
1117679858 14:58192855-58192877 CAGTAGGAATGGAGTAAAATAGG + Intronic
1118337912 14:64870107-64870129 CTGTAAGAAAGGAGTGAAAAGGG + Intronic
1118467049 14:66040468-66040490 CTGGAGGAATGGATTTCCAAGGG - Intergenic
1118527288 14:66660941-66660963 CTGGTGGAATGGATTCACAAGGG - Intronic
1118677810 14:68207314-68207336 CTGTGGGAATGAATTAAAATTGG - Intronic
1118862459 14:69675100-69675122 CTGGAAGAATGGTTTGAAGATGG + Intronic
1120107419 14:80512523-80512545 ATGACTGAATGGATTGAAAAAGG - Intronic
1125265882 15:37880388-37880410 CTATAGTAAGGGAATGAAAATGG + Intergenic
1125767468 15:42145161-42145183 CTGGAGGGATGGAGTGGAAAAGG + Intronic
1126336328 15:47589532-47589554 GGGTAGGATTGGATTGAAAGAGG - Intronic
1126801307 15:52299787-52299809 GTATAGGAATAGATTGAAATGGG - Intergenic
1127281769 15:57499062-57499084 GTGTGGGGATGGATTGGAAAGGG + Intronic
1127300860 15:57652159-57652181 ATGAAGGAATGGAGGGAAAAAGG - Intronic
1129096291 15:73212026-73212048 CGATACGAATGTATTGAAAAGGG - Intronic
1130103447 15:80911772-80911794 CTGCAGCAATGGACTCAAAAAGG + Intronic
1131315110 15:91328997-91329019 CTAGAGGAAAGGAGTGAAAAGGG - Intergenic
1133891477 16:9883451-9883473 CTGCAGGAATGAAGTGGAAAAGG + Intronic
1135255120 16:20935469-20935491 CTCCAGGAATGGATTGACAAGGG - Exonic
1138158705 16:54731905-54731927 CTGTGGCAATGGGATGAAAAAGG - Intergenic
1138219192 16:55236619-55236641 CAGCAGGGATGGAGTGAAAAAGG + Intergenic
1138753873 16:59458444-59458466 CTTTTGGAATGGAAGGAAAAAGG - Intergenic
1139239497 16:65376354-65376376 CTGTAGGAAAGTATTGTAGATGG + Intergenic
1139560598 16:67739265-67739287 ATGAAGTAATGGATGGAAAAGGG - Intronic
1139907673 16:70377966-70377988 CTATGGGAAAGGAATGAAAAAGG + Exonic
1140623942 16:76769783-76769805 ATGGAGGCATGGCTTGAAAAGGG + Intergenic
1141657925 16:85426008-85426030 CTCTAAGAATGAATGGAAAATGG + Intergenic
1141687334 16:85577821-85577843 CTGGAGGACTGGAGTGGAAAAGG - Intergenic
1141822820 16:86459353-86459375 CTGTCGGGATGAAGTGAAAATGG + Intergenic
1142000277 16:87660385-87660407 CTGTAGGGCTGGAGTGAAAGGGG + Intronic
1143175249 17:4951389-4951411 CAGCAGGGATGGATAGAAAAGGG + Intronic
1144609654 17:16699027-16699049 CTTTAGGAATGGAATTCAAAAGG - Intronic
1144650515 17:17004246-17004268 GTGGAGGAATGGGTTGAAGAGGG - Intergenic
1144826400 17:18107947-18107969 CTGAAATAAAGGATTGAAAACGG + Exonic
1144903116 17:18616524-18616546 CTTTAGGAATGGAATTCAAAAGG + Intergenic
1144927949 17:18829456-18829478 CTTTAGGAATGGAATTCAAAAGG - Intergenic
1145043286 17:19592682-19592704 ATTTAGGAATGGATTAACAAAGG + Intergenic
1145093421 17:20004451-20004473 CTGAAGAAAAGAATTGAAAATGG + Intergenic
1145129454 17:20330226-20330248 CTTTAGGAATGGAATTCAAAAGG - Intergenic
1146239342 17:31202436-31202458 CTGCAGGAATGGATAGAATATGG - Intronic
1150514047 17:65788995-65789017 CTATCGGAATGGATTAAAAAGGG - Intronic
1150664474 17:67119471-67119493 CTGGAGGATGGGATTGCAAAGGG + Intronic
1150842374 17:68620749-68620771 CTGGAGGGAAGGATGGAAAAAGG + Intergenic
1153381338 18:4442993-4443015 ATGAATGAATGGATTGACAATGG + Intronic
1155072389 18:22327825-22327847 CTGTTGGAAAGTATTTAAAATGG + Intergenic
1157196225 18:45622332-45622354 CTGAAGGAATGGCTTGGAAGGGG + Intronic
1158313201 18:56181475-56181497 CTGTAGGAAGAAATGGAAAAAGG + Intergenic
1159392946 18:67817939-67817961 TTGTAGGAATGAATATAAAATGG - Intergenic
1159500925 18:69268484-69268506 CTGTAAGAATGTTTTGATAAAGG - Intergenic
1162265166 19:9567210-9567232 CTGTATGCATGTAATGAAAATGG - Intronic
1162753684 19:12844300-12844322 CTATGGGCATGGATAGAAAAGGG - Intronic
1167277644 19:48548535-48548557 CTAGATGAATGGATGGAAAATGG + Intergenic
925421264 2:3713742-3713764 CTGTAGGGATTGATCTAAAATGG + Intronic
925428289 2:3769439-3769461 CTGATGGAATGGAGTGAAGACGG - Intronic
931087315 2:58847148-58847170 TTGTAGTAATGGATAGCAAACGG + Intergenic
931774432 2:65528250-65528272 CTGCAGGAATGGAAAGGAAAGGG + Intergenic
933174602 2:79160930-79160952 CAGTAAGAATGCAATGAAAAGGG - Intergenic
934192776 2:89814899-89814921 CTGATGGAATGGAATGAAATGGG - Intergenic
935462450 2:103354237-103354259 ATGTAGGAAGGGATTAAACAGGG + Intergenic
936523040 2:113224030-113224052 ATGGAGGAATAGATTGAAAAGGG + Intronic
939601234 2:144193368-144193390 GTGTAGTAATGGATTAAAATAGG - Intronic
939866743 2:147481482-147481504 CTGTAACAATGGCTTGCAAAGGG - Intergenic
941645791 2:168039654-168039676 AGGGAGGAATGGATTGCAAAAGG + Intronic
943036316 2:182750327-182750349 CAGTAGCAATGGGTTGGAAATGG + Intronic
943045349 2:182854578-182854600 CTGGAGGAATGGAATGCAAGAGG - Intronic
943123612 2:183769133-183769155 CAGAAGAAATGGATTCAAAAGGG - Intergenic
944443774 2:199769168-199769190 CTGTGGGAAAGGATGAAAAATGG - Intronic
947003029 2:225479127-225479149 CAATAGGAAAAGATTGAAAAAGG + Intronic
1169773479 20:9226632-9226654 CTATAGGAAAGGAAGGAAAATGG - Intronic
1170053435 20:12172340-12172362 CTGTAGCAATTGGCTGAAAATGG - Intergenic
1173517089 20:43672266-43672288 GTGTAGGCAAGGATTGAAAAGGG + Intronic
1175283485 20:57820971-57820993 CTGTAGGGATGGATTGCAGAGGG + Intergenic
1177458404 21:21375282-21375304 CTGTATGAATAGTTTTAAAAAGG - Intronic
1177631771 21:23738112-23738134 CTACAGGAATGGATTGAAAATGG + Intergenic
1179077968 21:38141914-38141936 TTGAAGGAATTGATAGAAAATGG + Intronic
1181257862 22:21575734-21575756 CAGGAGGAATGGCTTGAACATGG - Intronic
1184382566 22:44155109-44155131 ATGTAAGAATGGTTTGGAAAAGG - Intronic
1184460202 22:44633529-44633551 CTGGATGAATGCATGGAAAATGG + Intergenic
949093578 3:59436-59458 CTCAAGGACTGGATTGAAGAGGG - Intergenic
950204451 3:11067988-11068010 TTGCACGAATGAATTGAAAATGG - Intergenic
950337807 3:12212607-12212629 GTGCAGGAATTGATTGCAAATGG - Intergenic
950602788 3:14049586-14049608 CTGTAGGAATTCTTAGAAAATGG + Intronic
951083735 3:18485246-18485268 CTGTCAGAATGCATTGAGAAGGG - Intergenic
951507597 3:23465775-23465797 CTGTAGGAATTCAATTAAAATGG - Intronic
954188173 3:48936277-48936299 TTGTAGGAAAGATTTGAAAAAGG + Intronic
955033788 3:55246497-55246519 ATCCAGGAATGGATTTAAAAAGG + Intergenic
955898658 3:63727667-63727689 CTATTGGGCTGGATTGAAAATGG + Intergenic
963942228 3:151106342-151106364 CTGTAGGAAAGGAAAGGAAAGGG - Intronic
964696498 3:159513794-159513816 CTGCAGAAATGCATTGATAAGGG + Intronic
965419129 3:168435408-168435430 CTGTTGTAATGTAATGAAAATGG + Intergenic
968819402 4:2838107-2838129 CTGCAGGAAATGAATGAAAAAGG - Exonic
969871424 4:10107332-10107354 CAGGAGGACTGCATTGAAAATGG - Intronic
970433938 4:16014990-16015012 CTGCAGGAATGTATTAAAAAGGG + Intronic
970820267 4:20204175-20204197 CAGTAGGACTGGATGGAAGAAGG + Intergenic
971497451 4:27282092-27282114 AGGGGGGAATGGATTGAAAATGG + Intergenic
973798702 4:54454612-54454634 CTCTAAGAAAGGATTGAAAATGG + Intergenic
974429769 4:61780640-61780662 CAGTGGGAATGGATGGAAGAAGG - Intronic
974558885 4:63491616-63491638 CTGTAGAAATGGCAAGAAAATGG + Intergenic
976311857 4:83620940-83620962 CTGTAATATTGGATTGGAAATGG - Intergenic
976745943 4:88403068-88403090 TTGGAGGACTGTATTGAAAATGG + Intronic
978673939 4:111286868-111286890 CTGTATGAATAGTTTTAAAAAGG + Intergenic
978907115 4:114018690-114018712 GTGGAGGAAATGATTGAAAAAGG + Intergenic
979375050 4:119936780-119936802 CAGAAGAAATGCATTGAAAACGG - Intergenic
979698839 4:123644023-123644045 CTGTTGAAATGAATTGAATAAGG - Intergenic
979727014 4:123974377-123974399 TTGTAGGAAATCATTGAAAAAGG + Intergenic
980258796 4:130420341-130420363 CTGAAGGAAATGAATGAAAATGG + Intergenic
980599522 4:135002294-135002316 CTGTAGAAATTGATTTTAAAAGG + Intergenic
982522309 4:156433589-156433611 CTGTGGGAATGGATTAGAATTGG + Intergenic
985824853 5:2184622-2184644 TTATAGGAATGGATGGAAAAGGG + Intergenic
986107109 5:4670536-4670558 TTGTAGGAATGCTTTGAAAAGGG - Intergenic
986585240 5:9309559-9309581 CTGGAGGCATGGATTGAAGACGG + Intronic
987055703 5:14189426-14189448 CTGTAGAATTGGATTGAGGAGGG + Intronic
987594286 5:19975920-19975942 CTTTAGCACTGGACTGAAAATGG + Intronic
989154352 5:38329997-38330019 CTGTAGGAAAGTATTTAAATCGG - Intronic
989781494 5:45270325-45270347 CTGCAAGAAAGGATTTAAAACGG + Intronic
992488023 5:77214378-77214400 CTGTATGAATGGAGGGAAAACGG - Intronic
992630274 5:78673300-78673322 CAGTGGGAAGGGCTTGAAAAAGG - Intronic
993379000 5:87184041-87184063 CAGTAGGAATGAATGGAAATTGG - Intergenic
995673849 5:114639890-114639912 CTGATAGAATGAATTGAAAAAGG - Intergenic
996712340 5:126555595-126555617 CTGTAGCAATGGATGCAGAAAGG + Intronic
998137545 5:139682069-139682091 CTGTAGGATTGGCTTGGAGAAGG + Intronic
998781330 5:145659889-145659911 ATGTGGGAAGGGATAGAAAAGGG + Intronic
999579474 5:153020256-153020278 CTGTTGGGAGGAATTGAAAATGG + Intergenic
999676501 5:154008927-154008949 CTGTAGGGATGGATTAAAATTGG + Intronic
1000036702 5:157454192-157454214 CTGTAGGATGGGATTTAAAGTGG + Intronic
1000178288 5:158780650-158780672 CTGAAGGAATTTATTGAAAAGGG + Intronic
1001084199 5:168688438-168688460 CTTTAGGAATGGATAGAAGTGGG + Intronic
1001184124 5:169551198-169551220 CCTTAGGCATGGAGTGAAAAGGG - Intergenic
1003520586 6:6855434-6855456 TTGAATGAATGGATGGAAAATGG - Intergenic
1003731511 6:8829804-8829826 CTGTAGGACTGGATGGACAAAGG + Intergenic
1005761930 6:28975439-28975461 CTGTGGGAATGGACTACAAAAGG + Intergenic
1006479533 6:34280607-34280629 TTGTAGAAAGGGATAGAAAATGG - Exonic
1008982302 6:57498963-57498985 TTGTTTGAAAGGATTGAAAAGGG - Intronic
1009170370 6:60391804-60391826 TTGTTTGAAAGGATTGAAAAGGG - Intergenic
1010021395 6:71163858-71163880 CTGGAGGAATGGAGTGAGTATGG - Intergenic
1010565047 6:77400633-77400655 CTGAAGGCAGGGATTTAAAAAGG - Intergenic
1010712974 6:79196521-79196543 ATTTAGAAATGGATTAAAAATGG - Intergenic
1013286568 6:108687083-108687105 CTGTAGGAATGGATTCTAGAAGG + Intergenic
1013510362 6:110839263-110839285 CTCTAGGCAAGGAGTGAAAAGGG + Intronic
1015816141 6:137212580-137212602 CAGTAGGAATGGCTTTATAATGG + Intronic
1016097108 6:140051826-140051848 CTATAGTGATGCATTGAAAATGG - Intergenic
1019384011 7:743429-743451 CTGTAGGCGTGGATTTAACAGGG - Intronic
1019797337 7:3060781-3060803 CTGTTGGAGTGGATGTAAAATGG - Intergenic
1020108083 7:5431715-5431737 CTCTAGAAATGGATTGACATTGG - Intronic
1020868275 7:13592850-13592872 TTGGAGGAATAGATTGCAAATGG - Intergenic
1020952185 7:14694118-14694140 CTGGAGGAATGGATTCAAGGAGG - Exonic
1021180764 7:17503167-17503189 CAGTAGGAATAAATTGGAAAAGG - Intergenic
1022562216 7:31361388-31361410 CTGCATGAATGAATTAAAAAAGG - Intergenic
1022578291 7:31520861-31520883 ATGTAGGAATGGATTAGAGATGG - Intronic
1023460760 7:40393747-40393769 CTGAAGGAAGGGAATGAAGATGG + Intronic
1024412124 7:49056051-49056073 ATGTATGAATGGGTTAAAAAAGG - Intergenic
1026202384 7:68225671-68225693 ATATAGGAATGGATTAAGAAGGG + Intergenic
1027926268 7:84467657-84467679 ATGTTGGGATGCATTGAAAACGG - Intronic
1029238263 7:99142015-99142037 CTTTAGGGATGAATTGAAACTGG + Intronic
1030405748 7:109110834-109110856 ATGTAGAAATGGATTGGAAAGGG + Intergenic
1030409451 7:109157191-109157213 CTGTGACAATGCATTGAAAAAGG + Intergenic
1030687285 7:112499806-112499828 ATGTAGGAAAAGCTTGAAAAAGG - Intergenic
1031015642 7:116573601-116573623 CTATAGGCATGGATTCAAAGGGG + Intergenic
1031594780 7:123637469-123637491 CTGTAGGAATCGATTGGAAGAGG - Exonic
1031652697 7:124310664-124310686 CTGTATGATTATATTGAAAAAGG - Intergenic
1032693452 7:134312743-134312765 CTTTAGAAATGGAATGAAATGGG - Intronic
1032930502 7:136662797-136662819 CTCTAGGTATGCATTTAAAAAGG + Intergenic
1033639479 7:143247340-143247362 ATGGAGGAAGGGATTGCAAAGGG + Intronic
1037502071 8:19495919-19495941 CTGGAGGAAGGGAGTTAAAATGG - Intronic
1040764069 8:50885349-50885371 TTGGAGGAAATGATTGAAAATGG - Intergenic
1041522889 8:58774111-58774133 CTGTAGGAATTGATTGAAAGTGG - Intergenic
1042379841 8:68100827-68100849 TTGTAGGAATGGATTGCAAGGGG + Intronic
1043167977 8:76928046-76928068 CAGAAGGAAGGGACTGAAAAGGG - Intergenic
1044731635 8:95233059-95233081 CTGTTGGCAGGGATTGAGAATGG - Intergenic
1047679961 8:127244525-127244547 GTATAGGAATAGATTGAAATAGG - Intergenic
1047949727 8:129922332-129922354 TTGTAGGAATGGCTTTAAATTGG - Intronic
1049912992 9:287731-287753 CTGAATAAATGGACTGAAAATGG - Intronic
1051311372 9:15777466-15777488 CTGTAGTAATTCATTCAAAAAGG - Intronic
1051870427 9:21731061-21731083 ATGCAGGAATGGAGAGAAAATGG - Intergenic
1055220718 9:73927793-73927815 TTGTCTGAATGGATTAAAAAAGG + Intergenic
1055593732 9:77844555-77844577 CTGTAGGAAGAAATTAAAAATGG + Intronic
1056516556 9:87357379-87357401 GTGTAGAAATGCATTGAAACTGG + Intergenic
1056579232 9:87878314-87878336 TTGTAGGGATGGATTCAACAGGG - Intergenic
1058401250 9:104622628-104622650 ATATAGTAATAGATTGAAAATGG - Intergenic
1058794831 9:108488062-108488084 CTCAAGGAAAGGATTGACAAGGG - Intergenic
1060351561 9:122865730-122865752 CAATGGGAATAGATTGAAAAAGG + Intronic
1060532861 9:124358456-124358478 CTGTAAGAATGCATTCAAACGGG + Intronic
1061279786 9:129590918-129590940 CTGTAGGAGTGGAGTAACAAGGG + Intergenic
1061695515 9:132370340-132370362 CTGGAGGAAAGGATGGAAACAGG + Intergenic
1186093659 X:6077049-6077071 ATGTAGGAATGAAAGGAAAAAGG - Intronic
1186725916 X:12358609-12358631 CTGAAGGAAGGGATTTAAAACGG - Intronic
1189368644 X:40410234-40410256 CTGTAGGAATGGAATCCACAAGG - Intergenic
1189545477 X:42037964-42037986 GTCTAGGTATGGAGTGAAAAGGG + Intergenic
1190774545 X:53542245-53542267 CTGTAGTAAAGGAAAGAAAATGG - Intronic
1192264008 X:69526149-69526171 TTGTATGAATGGAATGAAAAGGG - Intronic
1192961595 X:76137251-76137273 CTGTGGGAAGGAATAGAAAAAGG - Intergenic
1194179188 X:90692166-90692188 CTGTAGGAATGGTTTGTAATTGG - Intergenic
1194509067 X:94769826-94769848 CTCTACCAATGGATTAAAAATGG + Intergenic
1195253653 X:103073072-103073094 ATGTAGCAATGGAATGAAACGGG + Intergenic
1195958537 X:110360810-110360832 CAGTGGGAATGGAAGGAAAATGG + Intronic
1196118215 X:112019850-112019872 CTGTTGGAAGGGCTGGAAAATGG + Intronic
1196340672 X:114592647-114592669 CTGTATTAATGGACTGAAATGGG - Intronic
1198077516 X:133208264-133208286 CTTTAAAAATGGATTGAATATGG - Intergenic
1198502291 X:137263305-137263327 CTGTAGGAATGGAAAGAAATTGG + Intergenic
1199534868 X:148891120-148891142 CTGGAGGACTGGCTTGAAAATGG - Intronic
1199539759 X:148945920-148945942 ATGTGGCAGTGGATTGAAAATGG + Intronic
1200525854 Y:4274332-4274354 CTGTAGGAATGGTTTGTATTGGG - Intergenic