ID: 1093234801

View in Genome Browser
Species Human (GRCh38)
Location 12:16594643-16594665
Sequence TTTCCCTTCATTACACTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 221}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093234801_1093234806 -2 Left 1093234801 12:16594643-16594665 CCCCACAGTGTAATGAAGGGAAA 0: 1
1: 0
2: 0
3: 24
4: 221
Right 1093234806 12:16594664-16594686 AATACAACGGTCATTTAGGTTGG 0: 1
1: 0
2: 0
3: 5
4: 61
1093234801_1093234807 16 Left 1093234801 12:16594643-16594665 CCCCACAGTGTAATGAAGGGAAA 0: 1
1: 0
2: 0
3: 24
4: 221
Right 1093234807 12:16594682-16594704 GTTGGTGCAATTCTTTTTTTAGG 0: 1
1: 0
2: 1
3: 27
4: 288
1093234801_1093234805 -6 Left 1093234801 12:16594643-16594665 CCCCACAGTGTAATGAAGGGAAA 0: 1
1: 0
2: 0
3: 24
4: 221
Right 1093234805 12:16594660-16594682 GGGAAATACAACGGTCATTTAGG 0: 1
1: 0
2: 0
3: 5
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093234801 Original CRISPR TTTCCCTTCATTACACTGTG GGG (reversed) Intronic
903415603 1:23180666-23180688 TTTCCCTGCATTAAACTCTCAGG + Intergenic
904344243 1:29857627-29857649 TTTCCCTTCAAAAGTCTGTGGGG - Intergenic
905857487 1:41323574-41323596 TTTCCCATCAGTAAACTGAGAGG + Intergenic
907716407 1:56930370-56930392 TTACCCAGAATTACACTGTGAGG - Intronic
909477854 1:76101814-76101836 TTTGGCTTCATTGCATTGTGAGG + Intronic
911008966 1:93259027-93259049 TTTCACTTTAATATACTGTGGGG + Intronic
911933516 1:103935518-103935540 TTTCCCTGCTTAACACTGTTAGG - Intergenic
912527496 1:110294618-110294640 GTTCCACTCATTCCACTGTGTGG + Intergenic
912809093 1:112780286-112780308 TGTCCCTTCATTTCTATGTGTGG + Intergenic
915495308 1:156278324-156278346 TTTCCCTTCATTATGCAGTATGG + Intronic
916021384 1:160795642-160795664 TCTCCCTACCTTACACTGAGGGG - Intergenic
917183149 1:172321459-172321481 ATTCCCTTCACTACTCTGTGTGG - Intronic
917350809 1:174075789-174075811 TTTTCCTTTAATACAATGTGAGG + Intergenic
917751553 1:178058008-178058030 TGTCGCTTCATACCACTGTGTGG - Intergenic
918456572 1:184725398-184725420 TTTCCCTTCATTAAAAAGTGTGG - Intronic
918806231 1:189049299-189049321 TATCCTTTCAGTACACTTTGAGG + Intergenic
919458750 1:197851240-197851262 TTTCCCTTCTTTATAATATGGGG + Intergenic
921836384 1:219782902-219782924 TTTAATTTCATTACACTGTGTGG - Intronic
922647319 1:227302108-227302130 TCTCCCTTCATTACAGTCTTAGG + Intronic
923664459 1:235987524-235987546 TTTCCCTTGATCAGACAGTGAGG + Intronic
923881969 1:238113445-238113467 TTTCCCATCAATACTTTGTGTGG + Intergenic
923947965 1:238911662-238911684 CTTTCCCTCATTACATTGTGTGG + Intergenic
1062980927 10:1722136-1722158 AAACCCTTCGTTACACTGTGGGG + Intronic
1063188015 10:3667717-3667739 TTTCGTTTCATTACATTGAGCGG + Intergenic
1063331413 10:5163498-5163520 ATTCCCTTCAGTAAACTGAGTGG + Intergenic
1065490001 10:26273289-26273311 CTTCTCTGCCTTACACTGTGGGG + Intronic
1067778574 10:49180209-49180231 TGTCCCTTGCTGACACTGTGGGG - Intronic
1068020184 10:51572321-51572343 TTTCCTTTCATTACTCTGTAAGG - Intronic
1068964098 10:62894597-62894619 TTGCCCTTCAAGACACTTTGGGG - Intronic
1070380247 10:75874839-75874861 TTTCCATTCATTCCAGTGAGTGG - Intronic
1070458597 10:76642643-76642665 TTTTCTTTCATTCCACTGTCTGG - Intergenic
1077630891 11:3810393-3810415 TTTCCCTTCTGTATACTGTGCGG + Intronic
1078747621 11:14130226-14130248 TCTCCCTACATCCCACTGTGAGG + Intronic
1078747703 11:14131190-14131212 TCTCCCTACATCCCACTGTGAGG - Intronic
1078879531 11:15434345-15434367 TTTCCCTGCTTTCCTCTGTGAGG + Intergenic
1083963130 11:66025618-66025640 TTTCCCCTCATTCCTCTGTGGGG - Exonic
1084267859 11:68014183-68014205 TTCCCCCTCATTAGACTGGGAGG - Intronic
1085319902 11:75567662-75567684 GTTACCTTCATTTCACAGTGAGG + Intronic
1088075920 11:105848462-105848484 TATGCTTTCATTACACTCTGGGG - Intronic
1089061006 11:115626096-115626118 TTTCCGGTCTTTTCACTGTGTGG - Intergenic
1089845902 11:121458060-121458082 TGTCCCTCCATTACAGTGGGTGG - Intronic
1092595840 12:10003965-10003987 TTTCCCTCAATCACACTGGGTGG - Intronic
1093234801 12:16594643-16594665 TTTCCCTTCATTACACTGTGGGG - Intronic
1093260481 12:16930745-16930767 CTTCCCTTCATTGTACTGTATGG + Intergenic
1093840149 12:23888335-23888357 TATCACTGCCTTACACTGTGTGG + Intronic
1094599876 12:31899061-31899083 TTTCCCTACATCATACTGTAAGG + Intergenic
1094869503 12:34584019-34584041 TTTCTTTTCATTGCACTGTTTGG - Intergenic
1096596034 12:52696142-52696164 TTTCACTTCATTTCACTTTCAGG + Intronic
1097266482 12:57748463-57748485 TTTCCCTTCTGGACACTGAGAGG - Exonic
1097835136 12:64265308-64265330 TTTTCCTTCATTACCCAATGAGG - Intronic
1098239771 12:68455366-68455388 TTTCCTTTCAGGACACTGTGGGG - Intergenic
1100502676 12:95189292-95189314 TTTTGCTTCTTAACACTGTGAGG + Intronic
1100569579 12:95834958-95834980 TTTGCCTTCACTAAACTGTTAGG - Intergenic
1101789984 12:107917787-107917809 TTGCCCTTCATAACTCTGTGAGG + Intergenic
1102834540 12:116042295-116042317 GTTTCCTTCATTACACTTTCAGG - Intronic
1104484445 12:129138125-129138147 TTGCCCTTCTTTACCCTGGGAGG - Intronic
1108577961 13:51805192-51805214 TTTCCTTTCATCACTCTGTCAGG - Intergenic
1108977522 13:56467145-56467167 TTTCCCTCCATCTCATTGTGTGG - Intergenic
1109242270 13:59904095-59904117 TTTCCCTTCTTTCCCCTTTGAGG - Intronic
1109384111 13:61605092-61605114 TTTCTCTTCATTATCCAGTGTGG - Intergenic
1110042555 13:70782392-70782414 TTTCCCTTCCTTACACTTCAAGG + Intergenic
1110961670 13:81633882-81633904 TTTCCCTGGATTACAATGTCAGG - Intergenic
1113400149 13:109984676-109984698 TTGCCCTTCATTATATTCTGGGG - Intergenic
1114841350 14:26266259-26266281 TTTCCCTTCTGAACTCTGTGTGG + Intergenic
1116154781 14:41189431-41189453 CTTCCCTTCAGTACACAGTGAGG - Intergenic
1116163651 14:41304963-41304985 TTTCCTTTCAATATACTGTGAGG - Intergenic
1116409557 14:44605843-44605865 TCTCCCTCTATTACACTGTATGG - Intergenic
1116731355 14:48626234-48626256 CTTCCCTTCCTTATACTGTGGGG - Intergenic
1118194304 14:63610634-63610656 TTTCTCATGATTAGACTGTGGGG - Intronic
1120228374 14:81816646-81816668 TTTCTCTTTATAACACTCTGTGG - Intergenic
1121705231 14:95988187-95988209 TAGCCCTTCAGTAAACTGTGTGG + Intergenic
1124179399 15:27458309-27458331 TTTATCTTCATTACACTTTAGGG + Intronic
1125744675 15:41990221-41990243 TTTGCATTCATTTCTCTGTGGGG + Exonic
1127294650 15:57598542-57598564 TTTCCCTTCCGTCCATTGTGTGG + Intronic
1127474071 15:59315661-59315683 TATCACTTCATCAGACTGTGAGG + Intronic
1127933573 15:63614329-63614351 TTTCCCATAGTTACTCTGTGAGG - Intronic
1128822600 15:70673302-70673324 TTACTCTTCATTTCACTCTGGGG - Intronic
1130924550 15:88375282-88375304 TTTCCTTTCATCTCCCTGTGCGG - Intergenic
1130968377 15:88714061-88714083 TTTCCCTCACTTACACAGTGAGG - Intergenic
1131670668 15:94616367-94616389 TTTCCTCTCATTAAAATGTGGGG - Intergenic
1135975243 16:27104425-27104447 TTTCTCTTTATTACATTCTGAGG + Intergenic
1136714089 16:32263204-32263226 TTTGTCTTCGTAACACTGTGGGG - Intergenic
1138437346 16:57010834-57010856 TTTCTCTTCCTTACACATTGGGG + Intronic
1140065568 16:71608382-71608404 TTTCCCTTCACCACATTGAGAGG + Intergenic
1141794553 16:86262061-86262083 TCTCCCTTCATAACAAGGTGAGG - Intergenic
1143363278 17:6388500-6388522 TTTCCCTTCTGTACACCGAGAGG + Intergenic
1145943559 17:28757212-28757234 TTTTCCTTCATTAAACTGAGGGG + Exonic
1146397046 17:32476718-32476740 TATACCTTCATCACTCTGTGGGG + Intronic
1147048914 17:37776458-37776480 TTCCCCCAAATTACACTGTGAGG - Intergenic
1148256951 17:46143157-46143179 TTTCCCTTTATTTCACTGGGAGG - Intronic
1150457906 17:65322552-65322574 ATTCACATCATTGCACTGTGAGG + Intergenic
1151809608 17:76430496-76430518 TTTTTCTTCATTCCACTTTGTGG + Intronic
1155821009 18:30376873-30376895 ATTCACTTCATTATACAGTGTGG - Intergenic
1158362023 18:56685502-56685524 TTTCTCTTGATCACACTCTGGGG + Intronic
1159366484 18:67472246-67472268 TTTCCATTCACTACAATATGGGG - Intergenic
1159837442 18:73355891-73355913 TTTCCCTTTGTTTCACTGAGAGG + Intergenic
1160137565 18:76285614-76285636 CTTCCTTTCTTTACATTGTGAGG - Intergenic
1164270815 19:23670125-23670147 TTTCACCTGATTCCACTGTGGGG + Intronic
1164518313 19:28955811-28955833 TATACATTCTTTACACTGTGGGG - Intergenic
1166867403 19:45848231-45848253 TGTGCCTTCATCACACTGAGTGG - Intronic
925600761 2:5606723-5606745 TTTCCCCTCTATACAATGTGAGG - Intergenic
926022825 2:9512184-9512206 TTTCTCTTCATTACACCTTTGGG - Intronic
926276090 2:11404191-11404213 AGTCCCTTCATTACACTCTTAGG + Intergenic
926922351 2:17951621-17951643 TTTCCCTTCATTACACACTCAGG - Intronic
927047389 2:19293378-19293400 TTTTCCACCATTACGCTGTGAGG - Intergenic
927747985 2:25640362-25640384 TTTGTCTTCATTACACGGTATGG + Intronic
928732021 2:34242486-34242508 TTTCCCTTCACTTCTTTGTGCGG + Intergenic
929816858 2:45239261-45239283 TTGCTCTTCCTGACACTGTGAGG - Intergenic
930693931 2:54391880-54391902 TTACAGTTCATTACCCTGTGTGG - Intergenic
931101882 2:59011217-59011239 TTTCCCATCCCTCCACTGTGAGG - Intergenic
933793959 2:85905464-85905486 TTTCCTTGCATTCCAGTGTGAGG + Intergenic
933819878 2:86101005-86101027 ATTCCCTTCATTGAACTGGGTGG - Intronic
933950739 2:87327020-87327042 ATTCCCTGCTTTACACTGAGAGG - Intergenic
934667083 2:96179641-96179663 CATCCCTTCATTACACAGTATGG + Intergenic
935199622 2:100845030-100845052 CTTCCCTTCTTTCCACTGTGAGG - Intronic
935892790 2:107697731-107697753 TTTCCATTTATTTCACTGAGAGG + Intergenic
936329039 2:111531558-111531580 ATTCCCTGCTTTACACTGAGAGG + Intergenic
936545648 2:113390796-113390818 TTTCCCCTCATCACACTCTTTGG + Intergenic
937190076 2:120086709-120086731 TCTCCCTCCATTACACAGGGTGG - Intronic
939509127 2:143084869-143084891 TTTCGCTTTATTGCACTTTGTGG + Intergenic
940140599 2:150487106-150487128 TTTCCCCTGATTAGACTGCGGGG - Intronic
940715720 2:157221408-157221430 TTTCTCTTCTTTACAGTTTGGGG - Intergenic
940838559 2:158552957-158552979 CTTCGCTTCATTACTCTCTGTGG - Intronic
942208106 2:173643268-173643290 TGTCATTTCATTACACTTTGTGG - Intergenic
942465579 2:176204377-176204399 CTTCCCTTCTTTCTACTGTGGGG - Intergenic
943853530 2:192758909-192758931 GTTCCATACATTACACTGTAGGG - Intergenic
946517612 2:220430353-220430375 TTTCTCTTAATTACAGTGAGTGG + Intergenic
947951707 2:234153164-234153186 TTTCTTTTCATCACACTGTCAGG + Intergenic
948760453 2:240187142-240187164 TTTCCCTGCAAAACTCTGTGAGG - Intergenic
1169014792 20:2282756-2282778 TTTCCCTTCCTTCCACTTTAGGG + Intergenic
1169795705 20:9460430-9460452 TTTCCCTTCCTTACAGTGTTAGG + Intronic
1171327953 20:24312312-24312334 TTTCCTTTCCAGACACTGTGTGG + Intergenic
1173135670 20:40436750-40436772 GGTCCCTTCCTTACACTGGGCGG + Intergenic
1175147335 20:56906892-56906914 TTTCCCTTCATTCCTCTGGCTGG - Intergenic
1175773566 20:61638880-61638902 ATTCCCTACCCTACACTGTGCGG - Intronic
1176673642 21:9757103-9757125 CTTCCCTTCAGGATACTGTGAGG - Intergenic
1177608243 21:23409724-23409746 TTTCCAAACATTACACTGTATGG + Intergenic
1178430851 21:32517657-32517679 TTCCCCTTCCTTCCACTGAGTGG - Intergenic
1178575106 21:33780305-33780327 TTTCACTTCATTACATTTTTGGG - Intronic
1181106285 22:20577642-20577664 TTTGTCCTCATTGCACTGTGTGG + Intronic
1183952554 22:41359710-41359732 TCTCTCTTCCTTACCCTGTGGGG - Exonic
949995203 3:9611175-9611197 TGTCCTTTCTTTACACTGGGAGG - Intergenic
950050052 3:9981291-9981313 TTTCTCTTGATTACACTGCCTGG - Intronic
950816941 3:15714642-15714664 TTTCCCATCTTTACTCTGGGGGG + Exonic
951329536 3:21349590-21349612 TTTCCCTTATTTACACACTGAGG - Intergenic
951659784 3:25049904-25049926 TTTCCCTTTACTAGACTTTGAGG - Intergenic
952006068 3:28843865-28843887 TTTCCCTTCTTAATACTCTGTGG + Intergenic
952043574 3:29289804-29289826 TTTCCTATCATTATATTGTGAGG + Intronic
952164732 3:30734940-30734962 TTTCCCCTCTTTACATTGTCAGG - Intronic
954004695 3:47581437-47581459 TTTCCCTTTCTTTCACTCTGTGG - Intergenic
957606961 3:82412486-82412508 TTGCCCTTCTTTACATTTTGAGG - Intergenic
959681933 3:109106005-109106027 ATTCCCCTCATTAAACAGTGAGG - Intronic
959790117 3:110349714-110349736 TTTGCTTTCATTACAATGTTCGG + Intergenic
960306341 3:116066173-116066195 TTCCCCTTCCATACTCTGTGAGG - Intronic
960942494 3:122943761-122943783 TATCCCTTCATGCCTCTGTGGGG - Intronic
962031838 3:131609094-131609116 TTTTCCTTCATTGCACAGTTGGG + Intronic
962406497 3:135105061-135105083 TTTCCATGCATTACTCTATGGGG - Intronic
962417244 3:135194172-135194194 TGTCCCTTCATCAAAATGTGGGG - Intronic
963085679 3:141434143-141434165 TTTCCCATCATTACAATGTACGG - Intronic
965916101 3:173847948-173847970 TCTCCATTCATTGGACTGTGAGG - Intronic
966699299 3:182828109-182828131 TTTCTTTTTAGTACACTGTGTGG + Exonic
966971624 3:185050158-185050180 TTTCACATCCTGACACTGTGAGG - Intronic
968009159 3:195261641-195261663 TTTCCCCTCCTTACCCTGTAAGG - Intronic
971072667 4:23112408-23112430 TTTCCCTTCTGTACATTCTGGGG + Intergenic
972118820 4:35674803-35674825 TTTCCATTCTTTTCACTTTGGGG + Intergenic
972647786 4:40985613-40985635 TTCCCCTTTATTACAGTTTGTGG - Intronic
972985561 4:44760289-44760311 TTTCAATTCTTTACAGTGTGCGG + Intergenic
979369332 4:119864720-119864742 TGTCCCATCATTTTACTGTGAGG + Intergenic
979430402 4:120622611-120622633 TTTCCATTCATTTCTCTCTGTGG - Intergenic
980465712 4:133177893-133177915 TCTTCCTTGATTACACTGTAAGG - Intronic
981803593 4:148686284-148686306 GTTCCTTTCATTTCAGTGTGGGG + Intergenic
981938616 4:150258628-150258650 TTTCCCTCCCTTGAACTGTGAGG + Intergenic
983965921 4:173809681-173809703 TTTTCCTGCATTACACAGAGTGG + Intergenic
985401066 4:189594566-189594588 CTTCCCTTCAGGATACTGTGAGG + Intergenic
986708319 5:10469544-10469566 TTTTCCTTAATTGCAGTGTGGGG + Intronic
987751759 5:22048167-22048189 TTTCTCATCATAAGACTGTGAGG + Intronic
989088402 5:37701036-37701058 TTTCCCCTCATTCCTCTGTCAGG + Exonic
989943453 5:50184709-50184731 TTTCCCTTGATTGCACAGTTTGG - Intergenic
991410469 5:66340641-66340663 TTTCCATACATTACATTGTTTGG + Intergenic
991976187 5:72185761-72185783 TTTTGCATGATTACACTGTGGGG + Intronic
993043249 5:82838901-82838923 TCTCCTTTCATTAAACTGTAAGG - Intergenic
994665599 5:102701154-102701176 TTTCACTTCCTTAAACTGGGAGG + Intergenic
994991298 5:107000039-107000061 GTGCCTTTGATTACACTGTGAGG + Intergenic
995015224 5:107302183-107302205 TTTCCCATCATTACACTGGAGGG - Intergenic
995843267 5:116465733-116465755 TTTCTTTTCATTTCACTGAGAGG - Intronic
997782332 5:136672546-136672568 GTTCTTTTCATTACACTGTTTGG + Intergenic
997862519 5:137430874-137430896 CTTGCCTTCTTTACACTGAGGGG + Intronic
998889074 5:146727190-146727212 TTTCCCTTCATTTCAGAGTGTGG + Intronic
999902645 5:156102036-156102058 CTTCCCTTCATTACACTTGCAGG + Intronic
1000086571 5:157892714-157892736 TTTCCCTTTATCAATCTGTGTGG - Intergenic
1000810233 5:165852624-165852646 TTTCCTTACATTTCACAGTGAGG + Intergenic
1003816163 6:9842991-9843013 TCTCCCTTCAATAGACTGTTAGG + Intronic
1004234556 6:13862577-13862599 TTACCCTTGGCTACACTGTGGGG + Intergenic
1006230516 6:32582348-32582370 TCTCACTCCATTCCACTGTGAGG + Intronic
1010858833 6:80878952-80878974 TTTCCCTTCATTACCCAGGCTGG - Intergenic
1011501476 6:87995279-87995301 TTTCCCATTATTTCACTGTAGGG - Intergenic
1011758353 6:90529086-90529108 TTTGCCTGCAGTACACTGTTAGG - Intronic
1012773508 6:103473539-103473561 TTTCGCTGCATTACACTGTCAGG - Intergenic
1015225199 6:130849759-130849781 TCTCCCTTGTTTAAACTGTGAGG - Intronic
1019572865 7:1721302-1721324 TTTCCCTGAGTTACACAGTGAGG - Intronic
1020689150 7:11333070-11333092 TTTCCCTTTATTAGACAGTAAGG + Intergenic
1023061818 7:36334778-36334800 TTCCCCTACATTAAACTGAGGGG - Intronic
1023440773 7:40182878-40182900 CTTCCCTTGATTCCACGGTGAGG - Intronic
1023600403 7:41876547-41876569 GTGCCCTTCATTACAGGGTGAGG - Intergenic
1024280620 7:47716097-47716119 ATTCCAATCATTACTCTGTGTGG + Intronic
1024903597 7:54350922-54350944 TTTCCTTTCAAGACACTGGGAGG - Intergenic
1024925891 7:54615246-54615268 TTTTCTTTCATTACACTGTATGG - Intergenic
1025520038 7:61715878-61715900 TTTCCATTCATCTCACTGAGTGG - Intergenic
1025527497 7:61834275-61834297 TTTCCTTTCATTCAGCTGTGTGG - Intergenic
1025544360 7:62144530-62144552 TTTCCATTCATCTCACTGAGTGG - Intergenic
1027752442 7:82166952-82166974 TTTCTCTACATTACACAGTAGGG + Intronic
1028830596 7:95323217-95323239 TTTCCCTTCCTTCCTCTGTCTGG + Intronic
1030567895 7:111183543-111183565 TTTCCCTTTATAACTCTCTGTGG - Intronic
1030819539 7:114079126-114079148 ATTTCCTTCATTAGAATGTGAGG + Intergenic
1032524675 7:132571033-132571055 TTTGACTTCTCTACACTGTGAGG - Intronic
1038460073 8:27708899-27708921 TTTCCCTCCCTTACAGTGTGTGG + Intergenic
1038814793 8:30891175-30891197 TTTGTCCTCATTGCACTGTGTGG + Intergenic
1039609122 8:38905073-38905095 TTTCCCTTCACTCCACTGCATGG + Intronic
1041597488 8:59673092-59673114 TTCTCTTTCAATACACTGTGAGG + Intergenic
1041839315 8:62249537-62249559 TGTTGCTTAATTACACTGTGTGG + Intronic
1044752864 8:95432794-95432816 TTTCCCTTGATTACACTGGAGGG + Intergenic
1046855961 8:119032383-119032405 TGTCCTCTCAGTACACTGTGTGG - Intronic
1047900413 8:129415416-129415438 TTTCCCTACATTAAGCTTTGGGG - Intergenic
1048548939 8:135415764-135415786 TCTCCCCTGATGACACTGTGAGG + Intergenic
1049488278 8:142877604-142877626 TCTCCCCTCAGGACACTGTGTGG - Intronic
1049493167 8:142915628-142915650 TCTCCCCTCAGGACACTGTGTGG - Intronic
1050025973 9:1334952-1334974 ATTCCCTACATCACACTGGGGGG + Intergenic
1050034519 9:1421435-1421457 TTTCCCCTAATTCCACTGGGTGG + Intergenic
1050235889 9:3579609-3579631 TTTCCCTGCATCAGACTGTCTGG - Intergenic
1050616316 9:7404990-7405012 TTTGCCTTCATCACACTGACTGG + Intergenic
1051595537 9:18821307-18821329 TGACCCTGCATGACACTGTGGGG - Intronic
1056128926 9:83565052-83565074 TTTCCCATGAAAACACTGTGGGG + Intergenic
1056227122 9:84506499-84506521 TGGCCTTTCATTACCCTGTGTGG + Intergenic
1056418073 9:86396765-86396787 TTTTGCTTAATTACTCTGTGAGG + Intergenic
1056652255 9:88476140-88476162 TACACCTACATTACACTGTGTGG - Exonic
1058775727 9:108281667-108281689 TTTCCCTTCATTTGACTGAAGGG - Intergenic
1059458205 9:114412938-114412960 CTTCCCCTCATTACAATGGGAGG + Intronic
1059974916 9:119705753-119705775 TTTCCTTACACTAAACTGTGAGG - Intergenic
1060460738 9:123852115-123852137 TGTCCCGCCATTACACTCTGGGG + Intronic
1062451756 9:136618696-136618718 TTTCACTTCCTTATCCTGTGAGG + Intergenic
1189929201 X:45989938-45989960 TTGCCCTTCTTTACTCAGTGGGG - Intergenic
1192570173 X:72196870-72196892 TTTATCTTCACTATACTGTGCGG - Exonic
1194655001 X:96561974-96561996 TTCCCCTTCATTTAACTGTGTGG + Intergenic
1195772303 X:108364328-108364350 TTTCCTTTCATTAGACAATGGGG - Intronic
1198690074 X:139272747-139272769 TTTATTTTCTTTACACTGTGTGG - Intergenic
1199169132 X:144716059-144716081 TTGACCTTCATTGCAATGTGAGG + Intergenic