ID: 1093238338

View in Genome Browser
Species Human (GRCh38)
Location 12:16639544-16639566
Sequence GAGCCCCTGCGCCTGGCCGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093238338_1093238343 5 Left 1093238338 12:16639544-16639566 CCATCGGCCAGGCGCAGGGGCTC No data
Right 1093238343 12:16639572-16639594 TGTAATCCCAGCACTTTGGGAGG No data
1093238338_1093238345 11 Left 1093238338 12:16639544-16639566 CCATCGGCCAGGCGCAGGGGCTC No data
Right 1093238345 12:16639578-16639600 CCCAGCACTTTGGGAGGCCGAGG No data
1093238338_1093238341 1 Left 1093238338 12:16639544-16639566 CCATCGGCCAGGCGCAGGGGCTC No data
Right 1093238341 12:16639568-16639590 CGGCTGTAATCCCAGCACTTTGG No data
1093238338_1093238342 2 Left 1093238338 12:16639544-16639566 CCATCGGCCAGGCGCAGGGGCTC No data
Right 1093238342 12:16639569-16639591 GGCTGTAATCCCAGCACTTTGGG No data
1093238338_1093238347 27 Left 1093238338 12:16639544-16639566 CCATCGGCCAGGCGCAGGGGCTC No data
Right 1093238347 12:16639594-16639616 GCCGAGGCAAGCAGATCACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093238338 Original CRISPR GAGCCCCTGCGCCTGGCCGA TGG (reversed) Intergenic