ID: 1093241065

View in Genome Browser
Species Human (GRCh38)
Location 12:16675278-16675300
Sequence CCCACTGATGTGACTACTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093241058_1093241065 23 Left 1093241058 12:16675232-16675254 CCTTTTGTGTCTATAATCTCACC No data
Right 1093241065 12:16675278-16675300 CCCACTGATGTGACTACTGTAGG No data
1093241062_1093241065 2 Left 1093241062 12:16675253-16675275 CCTGTAATATGGGGAAACAATGG No data
Right 1093241065 12:16675278-16675300 CCCACTGATGTGACTACTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093241065 Original CRISPR CCCACTGATGTGACTACTGT AGG Intergenic
No off target data available for this crispr