ID: 1093241933

View in Genome Browser
Species Human (GRCh38)
Location 12:16687350-16687372
Sequence ATCTGCCAGGGCCTCGATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093241933_1093241938 17 Left 1093241933 12:16687350-16687372 CCAAGATCGAGGCCCTGGCAGAT No data
Right 1093241938 12:16687390-16687412 TCTGCTTTCTAGTTCATAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093241933 Original CRISPR ATCTGCCAGGGCCTCGATCT TGG (reversed) Intergenic
No off target data available for this crispr