ID: 1093242703

View in Genome Browser
Species Human (GRCh38)
Location 12:16697552-16697574
Sequence CAGGGCTGTCTGAAGTTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093242698_1093242703 -5 Left 1093242698 12:16697534-16697556 CCAGCATAGCCACACAGGCAGGG No data
Right 1093242703 12:16697552-16697574 CAGGGCTGTCTGAAGTTTTGGGG No data
1093242694_1093242703 27 Left 1093242694 12:16697502-16697524 CCAAGTCATGAGAGCTGCTGGGT No data
Right 1093242703 12:16697552-16697574 CAGGGCTGTCTGAAGTTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093242703 Original CRISPR CAGGGCTGTCTGAAGTTTTG GGG Intergenic
No off target data available for this crispr