ID: 1093244295

View in Genome Browser
Species Human (GRCh38)
Location 12:16716821-16716843
Sequence GGGTGAACAAAAATGCTGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093244291_1093244295 9 Left 1093244291 12:16716789-16716811 CCTATAAAACCACTCTGGAAATA No data
Right 1093244295 12:16716821-16716843 GGGTGAACAAAAATGCTGATTGG No data
1093244292_1093244295 0 Left 1093244292 12:16716798-16716820 CCACTCTGGAAATAGATATGTTT No data
Right 1093244295 12:16716821-16716843 GGGTGAACAAAAATGCTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093244295 Original CRISPR GGGTGAACAAAAATGCTGAT TGG Intergenic
No off target data available for this crispr