ID: 1093244382

View in Genome Browser
Species Human (GRCh38)
Location 12:16718244-16718266
Sequence AAGGCTTTCCCTAGACTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093244382_1093244385 8 Left 1093244382 12:16718244-16718266 CCCTCTAGTCTAGGGAAAGCCTT No data
Right 1093244385 12:16718275-16718297 TTATTTCTGTGAAAAGTATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093244382 Original CRISPR AAGGCTTTCCCTAGACTAGA GGG (reversed) Intergenic