ID: 1093254690

View in Genome Browser
Species Human (GRCh38)
Location 12:16852707-16852729
Sequence GATTCATATTTTCAACTACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093254690_1093254693 3 Left 1093254690 12:16852707-16852729 CCAAGTAGTTGAAAATATGAATC No data
Right 1093254693 12:16852733-16852755 CATTTAAAATGGTGGCTTACAGG No data
1093254690_1093254691 -8 Left 1093254690 12:16852707-16852729 CCAAGTAGTTGAAAATATGAATC No data
Right 1093254691 12:16852722-16852744 TATGAATCAGACATTTAAAATGG No data
1093254690_1093254692 -5 Left 1093254690 12:16852707-16852729 CCAAGTAGTTGAAAATATGAATC No data
Right 1093254692 12:16852725-16852747 GAATCAGACATTTAAAATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093254690 Original CRISPR GATTCATATTTTCAACTACT TGG (reversed) Intergenic
No off target data available for this crispr