ID: 1093259181

View in Genome Browser
Species Human (GRCh38)
Location 12:16913901-16913923
Sequence CCTTGCATGGTGTATTAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093259177_1093259181 13 Left 1093259177 12:16913865-16913887 CCTTTGATTTTATTTATGAGTAT No data
Right 1093259181 12:16913901-16913923 CCTTGCATGGTGTATTAGTCAGG No data
1093259175_1093259181 22 Left 1093259175 12:16913856-16913878 CCCTTTTCACCTTTGATTTTATT 0: 5
1: 40
2: 384
3: 841
4: 2230
Right 1093259181 12:16913901-16913923 CCTTGCATGGTGTATTAGTCAGG No data
1093259176_1093259181 21 Left 1093259176 12:16913857-16913879 CCTTTTCACCTTTGATTTTATTT No data
Right 1093259181 12:16913901-16913923 CCTTGCATGGTGTATTAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093259181 Original CRISPR CCTTGCATGGTGTATTAGTC AGG Intergenic
No off target data available for this crispr