ID: 1093259418

View in Genome Browser
Species Human (GRCh38)
Location 12:16917390-16917412
Sequence CCTTGGTCCTTGAGTGAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093259418_1093259423 -3 Left 1093259418 12:16917390-16917412 CCAATTTCACTCAAGGACCAAGG No data
Right 1093259423 12:16917410-16917432 AGGGCTCTTCAGTTAGAAGGTGG No data
1093259418_1093259422 -6 Left 1093259418 12:16917390-16917412 CCAATTTCACTCAAGGACCAAGG No data
Right 1093259422 12:16917407-16917429 CCAAGGGCTCTTCAGTTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093259418 Original CRISPR CCTTGGTCCTTGAGTGAAAT TGG (reversed) Intergenic
No off target data available for this crispr