ID: 1093259899

View in Genome Browser
Species Human (GRCh38)
Location 12:16923031-16923053
Sequence ACTCATTTGAGAGCTTCATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093259899_1093259906 26 Left 1093259899 12:16923031-16923053 CCAAATGAAGCTCTCAAATGAGT No data
Right 1093259906 12:16923080-16923102 AGAGCCCACAGTATGTTTGGGGG No data
1093259899_1093259905 25 Left 1093259899 12:16923031-16923053 CCAAATGAAGCTCTCAAATGAGT No data
Right 1093259905 12:16923079-16923101 CAGAGCCCACAGTATGTTTGGGG No data
1093259899_1093259903 23 Left 1093259899 12:16923031-16923053 CCAAATGAAGCTCTCAAATGAGT No data
Right 1093259903 12:16923077-16923099 AACAGAGCCCACAGTATGTTTGG No data
1093259899_1093259904 24 Left 1093259899 12:16923031-16923053 CCAAATGAAGCTCTCAAATGAGT No data
Right 1093259904 12:16923078-16923100 ACAGAGCCCACAGTATGTTTGGG No data
1093259899_1093259901 -2 Left 1093259899 12:16923031-16923053 CCAAATGAAGCTCTCAAATGAGT No data
Right 1093259901 12:16923052-16923074 GTATGTTTTCAGAGGTACAGAGG No data
1093259899_1093259900 -10 Left 1093259899 12:16923031-16923053 CCAAATGAAGCTCTCAAATGAGT No data
Right 1093259900 12:16923044-16923066 TCAAATGAGTATGTTTTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093259899 Original CRISPR ACTCATTTGAGAGCTTCATT TGG (reversed) Intergenic
No off target data available for this crispr