ID: 1093259906

View in Genome Browser
Species Human (GRCh38)
Location 12:16923080-16923102
Sequence AGAGCCCACAGTATGTTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093259899_1093259906 26 Left 1093259899 12:16923031-16923053 CCAAATGAAGCTCTCAAATGAGT No data
Right 1093259906 12:16923080-16923102 AGAGCCCACAGTATGTTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093259906 Original CRISPR AGAGCCCACAGTATGTTTGG GGG Intergenic
No off target data available for this crispr