ID: 1093261983

View in Genome Browser
Species Human (GRCh38)
Location 12:16950188-16950210
Sequence GGAGCCGCAGCCACTTTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093261973_1093261983 12 Left 1093261973 12:16950153-16950175 CCTATTAATGTAGCTCTGCCCAA No data
Right 1093261983 12:16950188-16950210 GGAGCCGCAGCCACTTTGGCTGG No data
1093261981_1093261983 -7 Left 1093261981 12:16950172-16950194 CCAAGAGGGGCAGAGGGGAGCCG No data
Right 1093261983 12:16950188-16950210 GGAGCCGCAGCCACTTTGGCTGG No data
1093261980_1093261983 -6 Left 1093261980 12:16950171-16950193 CCCAAGAGGGGCAGAGGGGAGCC No data
Right 1093261983 12:16950188-16950210 GGAGCCGCAGCCACTTTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093261983 Original CRISPR GGAGCCGCAGCCACTTTGGC TGG Intergenic
No off target data available for this crispr