ID: 1093267171

View in Genome Browser
Species Human (GRCh38)
Location 12:17016904-17016926
Sequence TGAAAGTCCCAGAGTGTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093267171_1093267172 3 Left 1093267171 12:17016904-17016926 CCTCTCACACTCTGGGACTTTCA No data
Right 1093267172 12:17016930-17016952 TTCCACCTGTATCACAGTGTAGG No data
1093267171_1093267175 29 Left 1093267171 12:17016904-17016926 CCTCTCACACTCTGGGACTTTCA No data
Right 1093267175 12:17016956-17016978 TAGCCCGCTGCTTATTTCAAAGG No data
1093267171_1093267176 30 Left 1093267171 12:17016904-17016926 CCTCTCACACTCTGGGACTTTCA No data
Right 1093267176 12:17016957-17016979 AGCCCGCTGCTTATTTCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093267171 Original CRISPR TGAAAGTCCCAGAGTGTGAG AGG (reversed) Intergenic
No off target data available for this crispr