ID: 1093267172

View in Genome Browser
Species Human (GRCh38)
Location 12:17016930-17016952
Sequence TTCCACCTGTATCACAGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093267171_1093267172 3 Left 1093267171 12:17016904-17016926 CCTCTCACACTCTGGGACTTTCA No data
Right 1093267172 12:17016930-17016952 TTCCACCTGTATCACAGTGTAGG No data
1093267168_1093267172 20 Left 1093267168 12:17016887-17016909 CCAGAGGCAGTTATTCTCCTCTC No data
Right 1093267172 12:17016930-17016952 TTCCACCTGTATCACAGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093267172 Original CRISPR TTCCACCTGTATCACAGTGT AGG Intergenic
No off target data available for this crispr