ID: 1093268198

View in Genome Browser
Species Human (GRCh38)
Location 12:17026334-17026356
Sequence GGCAAGTCCCGCTTTTGTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093268198_1093268206 5 Left 1093268198 12:17026334-17026356 CCACTACAAAAGCGGGACTTGCC No data
Right 1093268206 12:17026362-17026384 GGGTGAAGGAGAAGGGGTTGAGG 0: 458
1: 207
2: 56
3: 137
4: 1396
1093268198_1093268202 -3 Left 1093268198 12:17026334-17026356 CCACTACAAAAGCGGGACTTGCC No data
Right 1093268202 12:17026354-17026376 GCCACTAAGGGTGAAGGAGAAGG 0: 148
1: 295
2: 218
3: 88
4: 242
1093268198_1093268201 -9 Left 1093268198 12:17026334-17026356 CCACTACAAAAGCGGGACTTGCC No data
Right 1093268201 12:17026348-17026370 GGACTTGCCACTAAGGGTGAAGG 0: 212
1: 594
2: 424
3: 169
4: 131
1093268198_1093268208 7 Left 1093268198 12:17026334-17026356 CCACTACAAAAGCGGGACTTGCC No data
Right 1093268208 12:17026364-17026386 GTGAAGGAGAAGGGGTTGAGGGG 0: 407
1: 144
2: 39
3: 71
4: 574
1093268198_1093268204 -2 Left 1093268198 12:17026334-17026356 CCACTACAAAAGCGGGACTTGCC No data
Right 1093268204 12:17026355-17026377 CCACTAAGGGTGAAGGAGAAGGG 0: 143
1: 304
2: 349
3: 426
4: 493
1093268198_1093268207 6 Left 1093268198 12:17026334-17026356 CCACTACAAAAGCGGGACTTGCC No data
Right 1093268207 12:17026363-17026385 GGTGAAGGAGAAGGGGTTGAGGG 0: 375
1: 236
2: 100
3: 101
4: 1002
1093268198_1093268205 -1 Left 1093268198 12:17026334-17026356 CCACTACAAAAGCGGGACTTGCC No data
Right 1093268205 12:17026356-17026378 CACTAAGGGTGAAGGAGAAGGGG 0: 147
1: 289
2: 224
3: 98
4: 363

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093268198 Original CRISPR GGCAAGTCCCGCTTTTGTAG TGG (reversed) Intergenic
No off target data available for this crispr