ID: 1093268286

View in Genome Browser
Species Human (GRCh38)
Location 12:17026834-17026856
Sequence AAAGATCCACCTATGACCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1010
Summary {0: 158, 1: 377, 2: 219, 3: 116, 4: 140}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093268286_1093268290 5 Left 1093268286 12:17026834-17026856 CCTGAGGTCATAGGTGGATCTTT 0: 158
1: 377
2: 219
3: 116
4: 140
Right 1093268290 12:17026862-17026884 AGAGCAAAGAGCAGGAGGACGGG 0: 69
1: 338
2: 269
3: 174
4: 696
1093268286_1093268294 23 Left 1093268286 12:17026834-17026856 CCTGAGGTCATAGGTGGATCTTT 0: 158
1: 377
2: 219
3: 116
4: 140
Right 1093268294 12:17026880-17026902 ACGGGGGATTGATCTCCCAAGGG 0: 49
1: 502
2: 196
3: 55
4: 96
1093268286_1093268292 7 Left 1093268286 12:17026834-17026856 CCTGAGGTCATAGGTGGATCTTT 0: 158
1: 377
2: 219
3: 116
4: 140
Right 1093268292 12:17026864-17026886 AGCAAAGAGCAGGAGGACGGGGG No data
1093268286_1093268291 6 Left 1093268286 12:17026834-17026856 CCTGAGGTCATAGGTGGATCTTT 0: 158
1: 377
2: 219
3: 116
4: 140
Right 1093268291 12:17026863-17026885 GAGCAAAGAGCAGGAGGACGGGG No data
1093268286_1093268289 4 Left 1093268286 12:17026834-17026856 CCTGAGGTCATAGGTGGATCTTT 0: 158
1: 377
2: 219
3: 116
4: 140
Right 1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG No data
1093268286_1093268287 -3 Left 1093268286 12:17026834-17026856 CCTGAGGTCATAGGTGGATCTTT 0: 158
1: 377
2: 219
3: 116
4: 140
Right 1093268287 12:17026854-17026876 TTTCTCACAGAGCAAAGAGCAGG 0: 64
1: 182
2: 304
3: 207
4: 418
1093268286_1093268295 26 Left 1093268286 12:17026834-17026856 CCTGAGGTCATAGGTGGATCTTT 0: 158
1: 377
2: 219
3: 116
4: 140
Right 1093268295 12:17026883-17026905 GGGGATTGATCTCCCAAGGGAGG 0: 514
1: 216
2: 52
3: 21
4: 83
1093268286_1093268288 0 Left 1093268286 12:17026834-17026856 CCTGAGGTCATAGGTGGATCTTT 0: 158
1: 377
2: 219
3: 116
4: 140
Right 1093268288 12:17026857-17026879 CTCACAGAGCAAAGAGCAGGAGG 0: 63
1: 168
2: 284
3: 215
4: 450
1093268286_1093268293 22 Left 1093268286 12:17026834-17026856 CCTGAGGTCATAGGTGGATCTTT 0: 158
1: 377
2: 219
3: 116
4: 140
Right 1093268293 12:17026879-17026901 GACGGGGGATTGATCTCCCAAGG 0: 49
1: 469
2: 221
3: 54
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093268286 Original CRISPR AAAGATCCACCTATGACCTC AGG (reversed) Intergenic
900840488 1:5045314-5045336 AAAGATCCACCTACGACCTCAGG + Intergenic
901899359 1:12345370-12345392 ACAGACACACCCATGACCTCCGG + Exonic
902970648 1:20045684-20045706 AAAGATCCACCTATGACCTTGGG - Intronic
903396259 1:23003897-23003919 GGAGATCCACCTACGACCTCAGG - Intergenic
904393735 1:30204138-30204160 AGAGATCCACCTACGACCTTGGG + Intergenic
905060810 1:35137513-35137535 AAAGATCCACCTAAGACCTTGGG - Intergenic
905499492 1:38425603-38425625 AAAGATCCACCTATGGCCTCAGG + Intergenic
906049282 1:42857226-42857248 AGAGATCCACCTATGACCTCGGG + Intergenic
906080619 1:43086000-43086022 AAAGATCCACCTACAACCTCAGG + Intergenic
906744834 1:48214311-48214333 AAAGGTCCACCTACGACCTCAGG - Intergenic
907233485 1:53023238-53023260 AAAGACACACCTGTGACCTTTGG + Intronic
907292343 1:53424845-53424867 AAAGATCCACCTATGACCTCAGG + Intergenic
907293371 1:53433059-53433081 GGAGATCTACCTATGACCTCAGG + Intergenic
907503870 1:54903086-54903108 AAAGATCCACCTATGACCTCAGG - Intergenic
907520986 1:55023247-55023269 AAAGATCCACCTACGACCTCAGG + Intergenic
908462004 1:64355217-64355239 AAAGATCCACCTACGACCTCAGG - Intergenic
908592344 1:65647502-65647524 AAAGATCCACCTACGACCTCAGG - Intergenic
908852045 1:68386516-68386538 AAAGATCCACCTACGACCTCAGG + Intergenic
909014491 1:70368138-70368160 AAAGATCCACCTACGACCTCTGG + Intronic
909035184 1:70588872-70588894 AAAGATCCACCTATGACCTGGGG + Intergenic
909222917 1:72984940-72984962 AAAGATCCACCTACGACCTCAGG - Intergenic
909223959 1:72993052-72993074 AAAGATCCACCTACGACCTCAGG - Intergenic
909551277 1:76899876-76899898 AAAGATCCACCTACAACCTCTGG - Intronic
909729164 1:78872693-78872715 AGAGATCTATCTATGACCTCGGG + Intergenic
909776950 1:79493608-79493630 AAAGATCCACCTACAACCTCAGG - Intergenic
909793271 1:79701531-79701553 AAAGATCCACCTATGACCTCAGG - Intergenic
909909645 1:81245812-81245834 AAAGATCCACCTACAACCTCAGG + Intergenic
909978727 1:82072631-82072653 AAAGATCCACCTATGACCTCAGG - Intergenic
910049076 1:82955801-82955823 AAAGATCCACCTATGACCTCGGG + Intergenic
910144148 1:84058817-84058839 AAAGATCAACCTACGACCTCAGG - Intergenic
911070855 1:93830820-93830842 GGAGATCCACCTACCACCTCAGG + Intronic
911148310 1:94572283-94572305 AAAGATCCACCTACGACCTCTGG - Intergenic
911510871 1:98806314-98806336 AAAGATCCACCTACGACCTCAGG - Intergenic
911570089 1:99510042-99510064 AAAGATCCACCTACGACCTCAGG + Intergenic
911658979 1:100478435-100478457 ATAGATCTATCTGTGACCTCGGG + Intronic
911760014 1:101602994-101603016 AAAGATCCACCTATGACCTCTGG - Intergenic
911966664 1:104380620-104380642 CAAAATCCACCTATGACCTAGGG + Intergenic
912296189 1:108473473-108473495 AAAGATCCACCTACGACCTCAGG + Intergenic
912813330 1:112810159-112810181 AAAGATCCACCTACGACCTCGGG + Intergenic
913244899 1:116862882-116862904 AGAGATCCACCTATGACCTCAGG + Intergenic
916328630 1:163591784-163591806 AAAGATCCACCTACAACCTCTGG + Intergenic
916941543 1:169683556-169683578 AAAGATCCACCTATGACCTCTGG + Intronic
918346706 1:183613720-183613742 AAAGATCCACCTACGACCTCAGG + Intergenic
918568006 1:185953663-185953685 AAAGATCCACCTACTACCTCAGG - Intronic
918714687 1:187770665-187770687 AAAGATCCACCTACGACATTAGG - Intergenic
919091159 1:192980077-192980099 AAAGATCCACCTATGATCTCTGG - Intergenic
919306574 1:195848035-195848057 AAAGATCCACCTACAGCCTCGGG - Intergenic
919476074 1:198035135-198035157 AAAGATCCACCTATGACCTCAGG + Intergenic
920427561 1:205890223-205890245 AGAGATCCACCTACGACCTTTGG - Intergenic
920829071 1:209449335-209449357 AAAGATCCACCTACGACCTCAGG + Intergenic
920901758 1:210115747-210115769 AAAGATCCACCTACGACCTCGGG - Intronic
920907785 1:210188094-210188116 AGACATCCACCTATGACCTTGGG + Intergenic
921460073 1:215415134-215415156 AAAGATCCACCTATGACCTCAGG - Intergenic
921509001 1:216008632-216008654 AAAGATCCACCTACGACCTCAGG + Intronic
921519859 1:216146130-216146152 AAAGATCCACCTACGACCTCAGG + Intronic
921732535 1:218594139-218594161 AAAGATCCACCTACGACCTCAGG + Intergenic
921733400 1:218599534-218599556 AAAGATCCACCTACGACCTCAGG - Intergenic
921977083 1:221214919-221214941 CAAAATCCACACATGACCTCTGG + Intergenic
922046167 1:221948322-221948344 GGAGATCCACCTATGACCTCGGG + Intergenic
922048122 1:221966433-221966455 AAAGATCCACCTACGACCTCAGG + Intergenic
922154361 1:223029601-223029623 AAAGATCCACCCACGACCTCAGG - Intergenic
922363818 1:224845583-224845605 AAAGATCCATCTACAACCTTGGG - Intergenic
922368229 1:224885863-224885885 GGAGATCCACCTACAACCTCAGG + Intergenic
922598747 1:226834016-226834038 GGAGATCCACATATGACCTTGGG + Intergenic
922845690 1:228682257-228682279 AGAGATCCACCTATGACGTCAGG - Intergenic
922877012 1:228947934-228947956 AAAGATCCACTTATGACCTCAGG + Intergenic
922906099 1:229174857-229174879 AAAGATCCACTTATGACCTCAGG + Intergenic
922934522 1:229412894-229412916 AAAGATCCACCTACGACCTCAGG + Intergenic
923074918 1:230601725-230601747 AAAGATCCACGTACAACCTCAGG + Intergenic
923214410 1:231835136-231835158 AAAGATCCACCTATGACCTCTGG - Intronic
923244453 1:232118644-232118666 AAAGATCCACCTACGACCCCAGG + Intergenic
923257567 1:232234449-232234471 AAAGATCCACCTATGACCTCAGG - Intergenic
923408944 1:233688686-233688708 AAAGATCCACCTATGACCTCAGG + Intergenic
923643753 1:235793586-235793608 AAAGATCCACCAATACTCTCTGG + Exonic
923771017 1:236937393-236937415 AAAGATCCATCTACGACCTCAGG - Intergenic
923989223 1:239416159-239416181 AAAAATCAACCTATGACCACTGG - Intronic
924180334 1:241434368-241434390 AAAGATCCACCTACAACCTCAGG + Intergenic
1062930525 10:1349499-1349521 AAAGATCCACCTACAACCTCGGG + Intronic
1063106647 10:2997978-2998000 AGAGATCCACCTATGACCTCAGG - Intergenic
1063362815 10:5471258-5471280 AAAGATCCACCTACGACCTCAGG + Intergenic
1063509935 10:6634992-6635014 AAAGATCCACCTATGACCTCAGG - Intergenic
1063527987 10:6802402-6802424 AAAGATCCACCTACGACCTCAGG - Intergenic
1064664093 10:17631956-17631978 AAAGATCCACCTACGACCTCAGG - Intergenic
1064887297 10:20124434-20124456 AAAGATCCACCTACGACCTCAGG - Intronic
1065443469 10:25774335-25774357 AAAGATCCACCTACGACCTCAGG - Intergenic
1065610294 10:27465840-27465862 AAAGATCCACCTACGACCTCGGG + Intergenic
1066103593 10:32138368-32138390 GGAGATCCACCTACGACCTCAGG - Intergenic
1066168861 10:32819378-32819400 ACAGCTCCACCTTTTACCTCTGG - Intronic
1066437585 10:35408198-35408220 AGAGATCCACCTATGACCTCAGG - Intronic
1067360093 10:45571647-45571669 AAAGGTCCACCTACGACCTCTGG + Intronic
1068058640 10:52039012-52039034 AAAGATCCACCTACGACCTCAGG - Intronic
1068179936 10:53504209-53504231 AAAGATCCACCTACAACCTCAGG - Intergenic
1068230664 10:54167205-54167227 AAAGATCCACCTATGACCTCAGG + Intronic
1068360558 10:55971977-55971999 AAAGATCCACCTATGACCTCGGG + Intergenic
1068592707 10:58866780-58866802 AAAGATCCACCTACGACCTCAGG - Intergenic
1070474544 10:76818787-76818809 AAAGATCCACCTACGACCTCAGG + Intergenic
1071187017 10:83057952-83057974 AGAGATCTACCTATGACCTCGGG + Intergenic
1071551013 10:86566205-86566227 GGAGATCCACCTATGACCTCGGG - Intergenic
1071898019 10:90086240-90086262 AAAGATCCACCTATGACCTCAGG - Intergenic
1071915917 10:90295491-90295513 AAAGATCCACCTACCACCTCAGG + Intergenic
1071960797 10:90807816-90807838 AAAGATCCACCTACGACCTCAGG + Intronic
1072011595 10:91306821-91306843 AAAGATTCACCTACAACCTCGGG - Intergenic
1073013643 10:100381379-100381401 GGAGATCCACCTATGATCTCAGG + Intergenic
1073394347 10:103205948-103205970 AAAGATTCACCTACGACCTCGGG + Intergenic
1073683297 10:105728081-105728103 AAAGATCCACCTACGACCTCAGG + Intergenic
1073709713 10:106022549-106022571 AAAGATCCACCTACGACCTCAGG - Intergenic
1073933144 10:108599540-108599562 AAAGATCCACCTACAACCTCGGG + Intergenic
1074018754 10:109562941-109562963 AAAGATCCACCTACGATCTCTGG + Intergenic
1074740476 10:116481161-116481183 AAAGATCCACCTACGACCTCAGG + Intergenic
1075248439 10:120845478-120845500 AAAGATCCACCTACAACCTCAGG + Intergenic
1075694357 10:124422660-124422682 CAAGCTCCACCTACGAACTCAGG + Intergenic
1075904380 10:126068114-126068136 AAAGTTACAGCTATGACTTCTGG - Intronic
1077590132 11:3484737-3484759 AAAGATCCACCTACGACCTCAGG - Intergenic
1077611882 11:3648385-3648407 AAAGACCCACCTACAACCTCAGG + Intronic
1077766699 11:5165605-5165627 AAAGATCCACCTACGACCTCAGG - Intronic
1077851139 11:6075333-6075355 AAAGATCCACCTATGACCTCAGG - Intergenic
1077883108 11:6366518-6366540 AAAGATCCACCTACGACCTTGGG + Intergenic
1078046419 11:7917367-7917389 AAAGATCCACCTAGGACCTCAGG - Intergenic
1078760739 11:14249323-14249345 ACAGGTCCACCGATGTCCTCGGG + Intronic
1078789002 11:14524766-14524788 AGAGATCCACCTATGACCTCGGG + Intronic
1079230290 11:18643757-18643779 AGAGATCCACCTACGACCTCGGG + Intergenic
1079447194 11:20568391-20568413 AAACATCCACCTACGACCTCAGG + Intergenic
1079672870 11:23189192-23189214 AAAGATCCACCTACGACCTCAGG - Intergenic
1079727385 11:23892425-23892447 AAAGATCCACCTATGACCTCAGG - Intergenic
1080028228 11:27634378-27634400 AAAGATCCACCTACGACCTCAGG - Intergenic
1080227092 11:29973873-29973895 AAAAATCCATCTATGACTTCAGG + Intergenic
1080994570 11:37582969-37582991 AAACATCCACCTATGACCTTGGG - Intergenic
1081159376 11:39734630-39734652 AGAGATCCACCTATGACCTCAGG + Intergenic
1081356540 11:42121175-42121197 AAAGATCCACCTACGATCTCAGG + Intergenic
1082197991 11:49326374-49326396 AAAGATTCATCTACAACCTCTGG - Intergenic
1082618800 11:55395845-55395867 ACAGCTCCTCCTTTGACCTCTGG + Intergenic
1082632640 11:55559872-55559894 AGGAATCCACCTATGACTTCAGG + Intergenic
1083161533 11:60857440-60857462 AATCATCCACCTATGTTCTCTGG - Intergenic
1083534101 11:63453169-63453191 AAAGATCCACCTATGACCTCAGG + Intergenic
1084046881 11:66574121-66574143 AAAGATCCACTTACGACCTCAGG + Intergenic
1084232010 11:67760174-67760196 AAAGATCCACCTACAACCTCAGG + Intergenic
1084245851 11:67856511-67856533 AAAGATCCACCTACGACCTCAGG - Intergenic
1084353740 11:68623278-68623300 AAAGATCCACCTATGACCTCAGG + Intergenic
1084355268 11:68634249-68634271 AAAGATCCACCTACGACCTCAGG + Intergenic
1084613591 11:70219655-70219677 AAAGATCCACCTATGACCTCAGG - Intergenic
1084826820 11:71738003-71738025 AAAGATCCACCTACGACCTCAGG + Intergenic
1085569966 11:77550690-77550712 GGAGATCCACCTACGACCTTGGG + Intronic
1085627011 11:78081376-78081398 GAAGATCTACCTACGACCTCGGG + Intergenic
1085934039 11:81122593-81122615 AAAGATCAACCTACGACCTCAGG + Intergenic
1085987717 11:81806645-81806667 AAAGATCCACCTACGACCTTGGG + Intergenic
1086004790 11:82025937-82025959 AAAGATCCACCTACGACCTCAGG + Intergenic
1086125537 11:83345086-83345108 AAAGATCCACCTACAACCTCGGG - Intergenic
1086132860 11:83419624-83419646 AAAGATCCACCTATGACCTCGGG + Intergenic
1086136566 11:83448085-83448107 AAAGATCCACCTATGACCTCGGG - Intergenic
1086362611 11:86074588-86074610 AAGGATTCATCTATGACCCCAGG - Intergenic
1086549963 11:88043880-88043902 AAAGATCCACCTATGACCTCTGG + Intergenic
1086657822 11:89381750-89381772 AAAGATCCACCTACAACCTCTGG + Intronic
1087098814 11:94346202-94346224 AAAGATCCACCTACGACCTCAGG + Intergenic
1087127515 11:94642088-94642110 AAAGATCCACCTACGACCTCAGG + Intergenic
1087196598 11:95309967-95309989 AAAGATCAACCTACAACCTCAGG + Intergenic
1087314331 11:96588164-96588186 AAAGATCCACCTATGACCTCAGG + Intergenic
1087839842 11:102909400-102909422 AAAGATCCACCTATGACCTCAGG - Intergenic
1089472375 11:118731340-118731362 AAAGATCCACCTACAATCTCAGG - Intergenic
1089808067 11:121109380-121109402 AAAGAGCCACCAAGGACATCAGG + Exonic
1089867323 11:121643009-121643031 AAAGATCCACCTACAAACTCGGG - Intergenic
1089952963 11:122547104-122547126 AAAGATCCACCTACAACCTCGGG + Intergenic
1090107825 11:123870565-123870587 AAAGATCCACCTATGACCTCAGG - Intergenic
1090850861 11:130569431-130569453 AAAGATCCACCTATGACCTCAGG - Intergenic
1090872232 11:130758587-130758609 AAAGATCCACCTATGACCTCAGG - Intergenic
1090927249 11:131259767-131259789 AAAGATCCACCTGCGACCTTGGG - Intergenic
1091183358 11:133627264-133627286 AAAGATCCACCTATGACCTCGGG + Intergenic
1091886230 12:4019070-4019092 AAAGATCCACCTATGATCTCAGG + Intergenic
1092416434 12:8293641-8293663 AAAGATCCACCTATGACCTCAGG - Intergenic
1092474176 12:8805360-8805382 AAAGATCCACCTACGACCTCAGG + Intergenic
1092593010 12:9968169-9968191 AAAGATCCACCTATGACCTCTGG - Intronic
1092627029 12:10338092-10338114 AAAGATCCACCTATGACCTCAGG - Intergenic
1092724022 12:11467470-11467492 AAAGATCCACCTACGACCTCAGG - Intronic
1092739577 12:11614738-11614760 AAAGATCCACCTATGACCTCAGG - Intergenic
1092789418 12:12058860-12058882 AAAGATCCACCTATGACCTCAGG + Intronic
1092925105 12:13265019-13265041 AAAGATCCACCTACGACCTCAGG - Intergenic
1092956659 12:13557322-13557344 AAAGAGCCACTTATGACCTCAGG - Exonic
1093071445 12:14710058-14710080 AAACATCCGCCTACGACCTCAGG - Intergenic
1093215194 12:16353557-16353579 AGAGATCAGTCTATGACCTCTGG + Intronic
1093268286 12:17026834-17026856 AAAGATCCACCTATGACCTCAGG - Intergenic
1093358292 12:18196237-18196259 AAAGGTTCACCTACGACCTCAGG + Intronic
1093578441 12:20763437-20763459 AAAGATCCACCTACGACCTCAGG + Intergenic
1093584783 12:20822086-20822108 AAAGATCCATCTACGACCTCAGG - Intronic
1093813087 12:23511027-23511049 AAAAATCCACCTACGACCTCGGG - Intergenic
1093950797 12:25163700-25163722 AAAGATTCACCTACGACCTCTGG + Intronic
1094329426 12:29275031-29275053 AAAGATCCACCTATGACCTCAGG + Intronic
1094400399 12:30056570-30056592 AAAGATCCACCTACGACCTCTGG + Intergenic
1094723655 12:33090321-33090343 AAAGATCCACCTACAACCTTGGG - Intergenic
1095637433 12:44450542-44450564 AAAGATCCACCTACGACCTCGGG + Intergenic
1096907416 12:54947878-54947900 AAAGATCCACCTACGACCTCTGG - Intergenic
1097398252 12:59102154-59102176 AAAGTTCCACCTACAACCTCAGG + Intergenic
1097417333 12:59328404-59328426 AAACATCCACCTACGACCTCAGG - Intergenic
1097542476 12:60957115-60957137 AAAGATCCACCTACGACCGTGGG - Intergenic
1097693890 12:62759281-62759303 AGAGATCCACCTATGACATCAGG + Intronic
1098173913 12:67771794-67771816 AAAGATCCACCTACGACCTCAGG - Intergenic
1098401924 12:70085806-70085828 AAAGATCCACCTACGACCTCAGG + Intergenic
1098628759 12:72703751-72703773 AACGATCCACCTACGACCTCAGG + Intergenic
1098630262 12:72713850-72713872 AAAGATCCACCTATGACCTCTGG - Intergenic
1098654128 12:73007216-73007238 AAAGATCCACCTACGACCTCTGG - Intergenic
1098919673 12:76292201-76292223 GGAGACCCACCTACGACCTCGGG + Intergenic
1099188420 12:79540377-79540399 AAAGATCCACCTATGACCTCAGG + Intergenic
1099292398 12:80788387-80788409 AAAGATCCACCTACGACCTCAGG - Intergenic
1099762284 12:86939211-86939233 AAAGATCCACCTACCACCTCAGG + Intergenic
1099836344 12:87912387-87912409 AAAGACCCACCTACGACCTTGGG - Intergenic
1100228438 12:92582682-92582704 AAAGATCCATCTATTGTCTCTGG + Intergenic
1100560991 12:95749361-95749383 AAAGATCCACCTATGACCTCAGG + Intronic
1100940009 12:99715676-99715698 AAAGATCCACCTATGACCTCGGG + Intronic
1102117028 12:110410606-110410628 GGAGATCCACTTATGACCTCGGG - Intergenic
1102599936 12:114022046-114022068 AAAGATCCACCTACAACCTCAGG + Intergenic
1102604193 12:114056247-114056269 AGAGATCCACCTACGACCTCAGG + Intergenic
1105031923 12:132890045-132890067 AAAGATCCACCTACGACCTCAGG + Intronic
1105718121 13:23087354-23087376 AAAGAGCTACCCATAACCTCAGG + Intergenic
1106124214 13:26886908-26886930 AGAGATTCTCCTAAGACCTCTGG + Intergenic
1106943187 13:34799435-34799457 AAAGATCCACCTACGACCTCAGG + Intergenic
1107075264 13:36316846-36316868 AAAGATCCACCTACAACCTCAGG + Intronic
1107683432 13:42872605-42872627 AAAGATCCACCTACGACCTCAGG - Intergenic
1108089817 13:46837259-46837281 AAAGATACACCTATTTCCCCAGG - Intronic
1108202382 13:48056842-48056864 AAAGATCCACCTACGACCTCGGG + Intronic
1108282270 13:48871932-48871954 AGAGATCCACCTATGACCTCGGG - Intergenic
1108429611 13:50340867-50340889 AAATAACCACCCATCACCTCAGG + Intronic
1108512700 13:51170393-51170415 AAACATCCACCTACGACCTCAGG + Intergenic
1108804105 13:54132660-54132682 AAAGATCTACCTAGGACCTCAGG - Intergenic
1108913724 13:55583537-55583559 AAAGATCCACCTACGACCTCAGG - Intergenic
1108919846 13:55660256-55660278 AAAGATCCACCTACTACCTCAGG - Intergenic
1108947144 13:56040780-56040802 AAAGATCCACCTATGACCTCAGG + Intergenic
1108953247 13:56117708-56117730 AAAGATCCACCTATGACCTCAGG - Intergenic
1109343313 13:61088944-61088966 AAAGATCTGCCTATGACCTCAGG + Intergenic
1109352787 13:61206162-61206184 AAAGATCCACTTACGACCACAGG + Intergenic
1109498997 13:63213627-63213649 AAAGATCCACCTAGGACCTCAGG + Intergenic
1109709943 13:66146506-66146528 AAAGATCCACCCATGACCTCAGG - Intergenic
1109717089 13:66231789-66231811 AAAGATCCACCTATGACCTCAGG - Intergenic
1110650803 13:77938879-77938901 AAAGATCCACCTATGACCTCGGG - Intergenic
1110765159 13:79274570-79274592 AAAGATCCACCTACGACCTCAGG + Intergenic
1110845032 13:80184038-80184060 AAAGATCCACCTACGACCTCGGG + Intergenic
1110978164 13:81866583-81866605 AAAGATCCACCTATGACCTCGGG + Intergenic
1111126295 13:83913312-83913334 AAAGATCCACCTACGACCTCAGG - Intergenic
1111293349 13:86196701-86196723 AATGATCCACCGAAAACCTCAGG - Intergenic
1111301709 13:86358695-86358717 AAAGATCCACCTATGACCTCAGG + Intergenic
1111362401 13:87191599-87191621 AAAGATCCACCTACGACCTCAGG - Intergenic
1111459179 13:88518192-88518214 AAAGATCCACCTACGACCTCAGG - Intergenic
1111630184 13:90840070-90840092 AAATATCCACCTACGACCTCAGG + Intergenic
1111631978 13:90853730-90853752 AAAGATCCACCTATGGCCTCAGG - Intergenic
1112236541 13:97642792-97642814 AAAGATCCACCTACGACCTCAGG + Intergenic
1112818265 13:103299432-103299454 AAAGATCCCCCTAGGAGCTGGGG - Intergenic
1112889626 13:104213321-104213343 AAAGATCCACCTACCACCTCAGG - Intergenic
1113323974 13:109265598-109265620 AAAGATCCACCTACGACCTTAGG + Intergenic
1114041036 14:18678504-18678526 TAATATCCCCCTATGACCTGTGG - Intergenic
1114221451 14:20701328-20701350 GGAGGTCCACCTATGACCTCAGG + Intergenic
1114478541 14:23015540-23015562 AAAGATTCTCCTATGACCATGGG - Intergenic
1114771256 14:25430445-25430467 AGAGATCCACCTACAACCTCTGG - Intergenic
1114845990 14:26322572-26322594 AAAGAACCACCTGTTACCTTTGG - Intergenic
1115240917 14:31250571-31250593 AAAGATCCACCTACGACCTCAGG - Intergenic
1115685123 14:35789012-35789034 AAAGATACACATCTGCCCTCAGG + Intronic
1115904487 14:38191162-38191184 AAAGAGCCACCTACGACCTCAGG + Intergenic
1116179374 14:41516399-41516421 AAAGATCCACCTACGACCTCAGG + Intergenic
1116535070 14:46017596-46017618 AAAGATCCACCTATGACCTCAGG - Intergenic
1116613242 14:47104756-47104778 AAAGATCCACCTACGACCTCAGG + Intronic
1116702656 14:48260440-48260462 AAAGATCCACCTACAACCTCTGG - Intergenic
1116703612 14:48267771-48267793 AAAGATCCCCCTACGACCTCAGG - Intergenic
1116952618 14:50893689-50893711 AAAAATCCACCTATGACCTTAGG + Intronic
1117173939 14:53129248-53129270 GGAGATCCACCTATGACCTCAGG + Intronic
1117958210 14:61138656-61138678 AAAGATCCACCTACGACCTCAGG - Intergenic
1118937610 14:70301438-70301460 AAAGATCCACCTACGACCTCAGG - Intergenic
1119316867 14:73703847-73703869 AAAGATCCACCTACGACCTCAGG + Intergenic
1119560569 14:75585975-75585997 AGAGATCCACCTACGACCTCGGG - Intronic
1119819386 14:77601649-77601671 AGAGATCTACCTACAACCTCAGG + Intronic
1120438357 14:84505464-84505486 AAAGATCCACCTATGACCTCAGG - Intergenic
1120539838 14:85738089-85738111 AAAGATCCACCTACGACCTCTGG - Intergenic
1120580308 14:86239918-86239940 AAAAATCCAGCTATGACCTAAGG - Intergenic
1120618025 14:86732075-86732097 AAAGATCCACCTAGGACCTCAGG + Intergenic
1120660270 14:87240282-87240304 AAAGATCCACCTACGACCTCAGG - Intergenic
1121193532 14:92049650-92049672 GGAGATCCACCTACGACCTCGGG - Exonic
1121289131 14:92760281-92760303 GAGAATCCACCTATGACCTCGGG + Intergenic
1121703361 14:95973509-95973531 AAAGATCCACCTACAACCTCAGG + Intergenic
1121980804 14:98452115-98452137 AAAGATCCACCTACGACCTCTGG - Intergenic
1122040715 14:98985763-98985785 AAAGATCCACCTATGACCTCAGG + Intergenic
1122887335 14:104715927-104715949 ATAGACCCACCCATGGCCTCGGG - Intronic
1123882725 15:24690526-24690548 AAAGATCCACCTACGACCTCTGG - Intergenic
1125045440 15:35239139-35239161 AAAGATCCACCTACGACCTCAGG + Intronic
1125213441 15:37241152-37241174 AAAGATCCACCTACGACCTCTGG - Intergenic
1125628922 15:41131890-41131912 GGAGCTCCACCTATGATCTCGGG + Intergenic
1125848852 15:42885259-42885281 AGAGATCTACCTATCACCTCAGG + Intronic
1126530426 15:49704244-49704266 AAAGATCCACCTATAACCTTGGG - Intergenic
1126843451 15:52739066-52739088 AAAGATCCACCTACAACCTCAGG + Intergenic
1126912663 15:53431931-53431953 AAAGATCCACCTACGACCTCAGG - Intergenic
1127115008 15:55717997-55718019 AAAGATCCACCTACGACCTCTGG + Intronic
1128600073 15:68988639-68988661 AGAGATCCACCTATGACCTTGGG + Intronic
1129259190 15:74354616-74354638 AAAGATCCACCTATGACCTCAGG + Intronic
1130847789 15:87763475-87763497 AAATATCCACCTTTGATCTTGGG + Intergenic
1130854788 15:87831634-87831656 AAAGATCCACCTATGACCTCAGG + Intergenic
1130947768 15:88561711-88561733 AAAGATCCACTTACAACCTCAGG - Intergenic
1131447399 15:92511848-92511870 GAAGATCCACCTATGACCACGGG + Intergenic
1131683893 15:94751239-94751261 AAAGGTCAACCTACGACCTCAGG + Intergenic
1131882819 15:96877116-96877138 AAAGATCCACCTATGACCTCAGG - Intergenic
1132262701 15:100440686-100440708 AAAGATCCACCTACGACCTCAGG + Intronic
1133651102 16:7815173-7815195 AAAGATCCACCTACGACCTCAGG + Intergenic
1133766998 16:8844928-8844950 AAAGATCCACCTACGACCTCAGG - Intronic
1133869907 16:9676721-9676743 GAAGATCCACCTACGACCTCAGG - Exonic
1135025630 16:18997103-18997125 GGAGATCCACCTATGACCTCGGG - Intronic
1135810618 16:25583574-25583596 AAACAACCACCTGAGACCTCTGG - Intergenic
1136529728 16:30859951-30859973 GGAGATCCACCTACGACCTTGGG + Intronic
1137055591 16:35745202-35745224 GAAAATCCACCTACAACCTCGGG - Intergenic
1137363207 16:47839238-47839260 AAAGATCCACCTACGACCTCGGG + Intergenic
1138759326 16:59522428-59522450 AAAGATCCACCTACAACCTCAGG - Intergenic
1138804597 16:60079064-60079086 AAAGATCCACCTATGACCTCAGG + Intergenic
1138846885 16:60577853-60577875 AAAGATCCACCTACGACCTCAGG - Intergenic
1139039719 16:62985003-62985025 AAAGATCCACCTACAACCTCAGG - Intergenic
1139943300 16:70621510-70621532 AAAGATCCACCTACGACCTCAGG - Intronic
1139943998 16:70625914-70625936 AAAGATCCACCTACCACCTCAGG - Intronic
1141796463 16:86278612-86278634 AAAGATCCACCTATGACCTCAGG + Intergenic
1141865480 16:86747104-86747126 AAAGATCCACCTACGACATCGGG - Intergenic
1142650950 17:1351468-1351490 AATGATACACCTCTCACCTCTGG - Intronic
1144104335 17:11972266-11972288 AAAGATCCACCTACGACCTCAGG + Intergenic
1145080886 17:19893396-19893418 GGAGATCCACCTACAACCTCGGG - Intergenic
1146597580 17:34183700-34183722 AAAGATCCACCTACGACCTCAGG + Intergenic
1148493600 17:48038390-48038412 AATGCTCCACCAATGACATCGGG + Intergenic
1149319293 17:55468250-55468272 GGAGATCCACCTATGACCTCAGG + Intergenic
1150328498 17:64275711-64275733 AGAGACCCACATGTGACCTCTGG - Intergenic
1150860711 17:68797508-68797530 GGAGATCCACCTATGACCTCGGG - Intergenic
1151622204 17:75253130-75253152 AAAGATCCACCTACGACCTCAGG + Intronic
1151840012 17:76610984-76611006 AAAGATCCACCTATGACCTCAGG - Intergenic
1155697322 18:28698350-28698372 AAAGATCCACCTATGACCTCAGG - Intergenic
1155892970 18:31289426-31289448 AAAGATACACCTACGACCTCTGG - Intergenic
1155941254 18:31804261-31804283 AAAGATCCACCTACGACCTCAGG + Intergenic
1155961727 18:32001019-32001041 GGAGATCCACCTATGACCTCGGG + Intergenic
1155999536 18:32369743-32369765 AAAGAACCACCTATACCCTTAGG + Intronic
1156237119 18:35216489-35216511 AAAGATCCACCTACAACCTCGGG + Intergenic
1156252164 18:35361283-35361305 AAAGATCCACCTACGACCTCGGG - Intergenic
1156302007 18:35844581-35844603 AAAGATTCACCTATGACCTCGGG + Intergenic
1156878994 18:42053179-42053201 AATGATCCAGCTAAGAACTCTGG + Intronic
1156915598 18:42462305-42462327 AAAGATCCACCTACGACTTTGGG + Intergenic
1156924318 18:42557592-42557614 AAAGATCCACCTACAAGCTCGGG - Intergenic
1156938330 18:42737517-42737539 AAAGGTACACTTATGACCTCAGG + Intergenic
1157076207 18:44470452-44470474 GAAGATCCAGCTACTACCTCCGG + Intergenic
1158336054 18:56415962-56415984 AAAGATCCACCTACGACCTCAGG + Intergenic
1158394955 18:57071951-57071973 AAAGATCCACCTACAACCTCAGG - Intergenic
1158576978 18:58646242-58646264 GGAGATCCACCTATGACCTCAGG - Intergenic
1158582867 18:58700545-58700567 AAACATCCAGCTGTGACCACTGG - Exonic
1159164188 18:64682210-64682232 AAAGATCCACCTACGACCTCAGG + Intergenic
1159834742 18:73325124-73325146 AAAGATCCACCTATGACCTCAGG + Intergenic
1159929003 18:74293268-74293290 AAAGATCCACCTACAACCTCGGG + Intergenic
1161241681 19:3226565-3226587 AAAAGCCCACCTATCACCTCTGG - Intronic
1161603965 19:5204249-5204271 AAAGAGCCCCCTATGACCTCAGG - Intronic
1161661442 19:5549093-5549115 AAAGATCCACCTACCACCTCAGG + Intergenic
1161710943 19:5847699-5847721 AGAGATCCACCTACAACCTCAGG + Intronic
1162242448 19:9365912-9365934 AAAGATCCACCTATGACCTCAGG - Intronic
1162274441 19:9641671-9641693 GGAGATCCACCTATGACCTCGGG - Intronic
1162286407 19:9742252-9742274 GGAGATCCACCTATGACCTCGGG + Intergenic
1163209369 19:15829273-15829295 AGAGATCCACCTGCGACCTCGGG + Intergenic
1163487022 19:17594002-17594024 AAAGATCCACCTACGACCTCGGG + Intergenic
1163900586 19:20096236-20096258 AAAGATTCACCTATGACCTCAGG - Intronic
1163906737 19:20155042-20155064 AATGACCCACCTGTGACCTCAGG + Intergenic
1163944670 19:20523999-20524021 GGAAATCTACCTATGACCTCGGG - Intergenic
1164080578 19:21858584-21858606 GGAGATCCACCCATGACCTTTGG + Intergenic
1164152701 19:22568830-22568852 AAACATCCACCTACGACCTCAGG + Intergenic
1164202719 19:23031745-23031767 GGAGATCCACCTACAACCTCGGG - Intergenic
1164258533 19:23549980-23550002 GGAGATCCACCTACAACCTCGGG + Intronic
1164459555 19:28435251-28435273 AAAGATCCACCTACGACCTCAGG - Intergenic
1165248967 19:34514575-34514597 AAAGATCCACGTACAATCTCTGG + Intergenic
1165497272 19:36160479-36160501 AAAGATCCACCTATGACCTCAGG - Intergenic
1165510611 19:36264692-36264714 AGAGATCCACCTATGAGCTCAGG - Intergenic
1166499268 19:43328852-43328874 AAAGATCCACCTACAACCTCAGG - Intergenic
1166917094 19:46202883-46202905 TGAGATCCACCCATGACCTCGGG - Intergenic
1166927394 19:46278335-46278357 AAAGATCCACCTATGACCTCAGG - Intergenic
1167046874 19:47054876-47054898 AAAGATCCACCTACGACCTCAGG - Intergenic
1167099143 19:47393349-47393371 AAAGATCCACCTGTGACCTCAGG + Intergenic
1167901862 19:52628270-52628292 GAAGATCCACCTACGACCTCAGG + Intronic
1168051331 19:53831933-53831955 AAACATCCACTTACGACCTCAGG + Intergenic
1168228267 19:55011918-55011940 AAAGATCCACCTACGACCTCAGG - Intergenic
1168247905 19:55123299-55123321 AAGGATCCACCTATGACCTCGGG + Intergenic
1168486932 19:56771314-56771336 AAAGATCCAACCCTGTCCTCAGG + Intergenic
925544217 2:5001295-5001317 AAAGATCCACCTACGACCTCAGG + Intergenic
925829239 2:7878340-7878362 AAAGATCCACCTACGACCTCAGG - Intergenic
926407451 2:12570186-12570208 AAAGATCCACCTATGACCTCAGG + Intergenic
926413271 2:12626848-12626870 AAAGATCCACCTATGACCTCAGG + Intergenic
926464369 2:13169163-13169185 AAAGATTCACCTATGACCTCAGG - Intergenic
926815854 2:16797171-16797193 AAAGATCCACCTATGACCTCAGG - Intergenic
927133941 2:20083091-20083113 AAAGATCCACCTATGACCTCTGG + Intergenic
927231150 2:20825300-20825322 TAAATTCCACCTATGACCTGTGG - Intergenic
928770854 2:34700856-34700878 AAAGATCCACGTACGACCTCTGG - Intergenic
928778033 2:34790306-34790328 GAAGATCCACCTACGACCTCTGG + Intergenic
928827892 2:35442084-35442106 AACGATCCACCTACAACCTCGGG - Intergenic
928928272 2:36599605-36599627 AAAGATCCACCTACGACCTCAGG + Intronic
928938103 2:36701625-36701647 AAAAATATACCTATGCCCTCGGG + Intronic
929076987 2:38086014-38086036 AAAGATCCACCTACGACCTCAGG - Intronic
929383260 2:41378339-41378361 GAATATCCACCTATGACCTTGGG + Intergenic
929684815 2:44024328-44024350 AGAGATCCACCTACGACCTCAGG - Intergenic
929793372 2:45039658-45039680 AAAGATCCACGTACGACCTCAGG - Intergenic
930099351 2:47590968-47590990 GAAGATCCACCTATGACCTCGGG - Intergenic
930487596 2:52027086-52027108 AAAGATACACCTACGACCTCTGG - Intergenic
930954707 2:57192810-57192832 AAAGATCCACCTACGACCTCAGG + Intergenic
930954821 2:57193573-57193595 AAAGATCCACCTACGACCTCAGG + Intergenic
931026688 2:58118599-58118621 AAAGATCCACCTACGACCTCAGG - Intronic
931042397 2:58314644-58314666 AAAGATCCACCTACAAGCTCAGG + Intergenic
931236586 2:60417912-60417934 AAAGATCCACCTACGACCTCAGG + Intergenic
931625465 2:64252974-64252996 AAAGATCCACCTACGACCTCAGG + Intergenic
931850125 2:66244415-66244437 AAAGATCCACCTACGACCTCAGG + Intergenic
931947952 2:67331993-67332015 AAAGGTCCACCTACGACCTCAGG + Intergenic
932159747 2:69448843-69448865 AAGGATCCACTTATGACCTCAGG - Intergenic
932295523 2:70620976-70620998 AAAGATCCCCCTACAACCTCAGG + Intronic
932359157 2:71090446-71090468 AAAGATCCACATACGACCTCAGG - Intergenic
932854496 2:75218979-75219001 AAAGATCCACCTACGACCTCAGG - Intergenic
932947114 2:76247693-76247715 ATAGCTCCACCTATCACATCAGG - Intergenic
932974262 2:76579153-76579175 AAAGATCCACCTACGACCTCAGG - Intergenic
933012771 2:77088753-77088775 AAAGATCCACCTACGACCTCAGG + Intronic
933078982 2:77965645-77965667 AAAGATCCACCTATGACCTCAGG + Intergenic
933137712 2:78758652-78758674 GGAGATCCACCTGCGACCTCAGG + Intergenic
933163448 2:79051877-79051899 AAAGATCCACCTATGACCTCAGG + Intergenic
933180099 2:79217208-79217230 AAAGATCCACTTACGATCTCAGG - Intronic
933329820 2:80879695-80879717 AAAGATCCACCTACGACCTCAGG - Intergenic
933552650 2:83793972-83793994 AAAGATCCACCTATGACCTCAGG - Intergenic
935241012 2:101178311-101178333 AGAGATCCACCTACAACCTTGGG - Intronic
936870572 2:117131078-117131100 GGAGATCCACCTATGACCTCAGG + Intergenic
936883057 2:117279282-117279304 AAAGATCCACCTACGACCTCAGG + Intergenic
937492689 2:122386393-122386415 AAAGTTCCACCTGTGCACTCTGG - Intergenic
938973372 2:136452422-136452444 AAAGAGCAACCAATGTCCTCTGG - Intergenic
939083428 2:137688153-137688175 AAAGATCCACCTACGACCTCAGG - Intergenic
939307180 2:140426880-140426902 AAAGATCCACCTACCACCTCAGG + Intronic
939460967 2:142494844-142494866 AAAGATCCACCTACGACCTCTGG - Intergenic
939780367 2:146438935-146438957 AAAGATGTATCTTTGACCTCTGG - Intergenic
940182715 2:150953817-150953839 AAAGAGCCACCTACAACCTCTGG + Intergenic
940216585 2:151309556-151309578 AGAGATCCACCTACGACCTCAGG + Intergenic
940529890 2:154867803-154867825 AAAGATCCACCTACGACCTCAGG + Intergenic
940818718 2:158327419-158327441 AAGGACCCACCTACCACCTCAGG + Intronic
941340109 2:164296337-164296359 AAAGATCCACCTACGACCTCAGG + Intergenic
941353121 2:164459720-164459742 AAAGATCCACCTACGACCTCAGG + Intergenic
941456465 2:165715617-165715639 AAAGATCCACCTACGATCTCAGG - Intergenic
941936184 2:170982885-170982907 AAAGATCCACCTACGACCTCAGG - Intergenic
942096805 2:172542280-172542302 AAAGATCCACCTACGACCTCTGG + Intergenic
942730544 2:179056831-179056853 AAAGATCCATCTACGACCTCTGG - Intergenic
943061322 2:183044558-183044580 AAAGATCCACCTATGACCTCTGG + Intergenic
943413219 2:187565597-187565619 AAAGATCCACCTACGACCTCAGG - Intronic
943421879 2:187675718-187675740 AAAGATCCACCTATGACCTCAGG - Intergenic
943449902 2:188033991-188034013 AAAGATCCACCTACGACCTCTGG + Intergenic
943461432 2:188174185-188174207 AAAGATCCACCTACGATCTCTGG - Intergenic
943592926 2:189821004-189821026 AAAAATAACCCTATGACCTCTGG + Intronic
943710673 2:191092079-191092101 AAAGATCCAACTTTTACTTCTGG - Intronic
943834866 2:192506569-192506591 AAAGATCCACCTACAACCTCAGG + Intergenic
943865121 2:192918800-192918822 AAAGATCCACCTACAACCTCAGG + Intergenic
943951568 2:194136044-194136066 AAAGATCCACCTACGACCTCAGG - Intergenic
944250799 2:197578853-197578875 AAAGATCCATCTACAACCTTGGG + Intronic
944387154 2:199179893-199179915 AAAGATCCACTTATGACCTCAGG + Intergenic
944393841 2:199247430-199247452 AAAGATCCACCTATGACCTCAGG + Intergenic
944876428 2:203967177-203967199 AAAGATCCACCTGTGACCTCAGG - Intergenic
944909291 2:204293566-204293588 AAAGAGCCACCTAATACCTTTGG - Intergenic
945153406 2:206812076-206812098 AAAGATCCACCTACGATCTCAGG - Intergenic
945173156 2:207017706-207017728 AAAGATCCACCTACGACCTCAGG + Intergenic
945301775 2:208221430-208221452 AAAGATCCACCTACGACCTCAGG - Intergenic
945360837 2:208894245-208894267 AAAGATCCACCTACGACCTCAGG + Intergenic
945375806 2:209078548-209078570 AAAGATCCACCTACAACCTCAGG + Intergenic
945394046 2:209299869-209299891 AAAGATCCACCTACGACCTCAGG + Intergenic
945857903 2:215090380-215090402 GGAGATCCACCTACCACCTCGGG + Intronic
945938011 2:215922834-215922856 AAAGATCCACCTATGACCTCAGG + Intergenic
946215356 2:218179357-218179379 AAAGATCCAACTATGACCTCAGG - Intergenic
946781327 2:223195001-223195023 AAAGATCCACCTACGACCACAGG - Intronic
946872054 2:224093007-224093029 AAAGATCCACCTACAACCTCGGG - Intergenic
946886207 2:224225807-224225829 AAAGATCCACCTACGACCTCAGG + Intergenic
948390346 2:237607274-237607296 AAATATCCACCTACGACCTCAGG + Intergenic
1168739126 20:173303-173325 AAAGATCCACCTACGACCTCAGG + Intergenic
1168943556 20:1733039-1733061 AAAGATCCACCTATGACCTCGGG - Intergenic
1169523466 20:6398138-6398160 AAAGTTCCTCCTATGACCATTGG - Intergenic
1169649718 20:7853531-7853553 AAATATCTACCTATTTCCTCTGG - Intergenic
1170069142 20:12345407-12345429 AAAGATCCACCTACGACCTCAGG - Intergenic
1170105926 20:12754353-12754375 AAAGATCCACCTACGACCTCAGG + Intergenic
1170165587 20:13358409-13358431 AAAGATCCACCTATGACCTCAGG + Intergenic
1170325778 20:15153051-15153073 AAAGATCCACCTACGACCTCAGG - Intronic
1170680668 20:18522549-18522571 AGAGATCCGCCTACGACCTCAGG - Intronic
1170820980 20:19756247-19756269 AAAGATCCACCTACGACCTCAGG - Intergenic
1171395706 20:24831678-24831700 TTAAATCCACCTATGACCTGTGG + Intergenic
1172932816 20:38598287-38598309 AAAGATCCACCTATGACCTCGGG - Intergenic
1173118580 20:40269579-40269601 AAAGATCCACCTATGACCTCAGG + Intergenic
1173651746 20:44670765-44670787 AGAGATCCACTTACGACCTCGGG + Intergenic
1173781349 20:45759830-45759852 AAAGATCCACCTATGACCTCAGG + Intronic
1176071659 20:63229907-63229929 AAAATTCAACCTCTGACCTCAGG + Intergenic
1177031411 21:15984802-15984824 AAAGATCCACCTATGACCTCGGG - Intergenic
1177100339 21:16892690-16892712 AAAGGTCCACCTACAACCTCAGG + Intergenic
1177102426 21:16914607-16914629 AAAGATCCACCTACGACCTCTGG + Intergenic
1177119271 21:17121970-17121992 AAAGATCCACCTATGACCACGGG + Intergenic
1177840961 21:26232977-26232999 AAAGATCCACCTATGACCTCGGG - Intergenic
1178000967 21:28161918-28161940 AAAGATCCACCTACAACCTCAGG + Intergenic
1178549177 21:33520934-33520956 AAAGATCCCCTTCTGGCCTCTGG - Exonic
1179015531 21:37591996-37592018 AAAGATCCACCTACGACCTCTGG - Intergenic
1179387232 21:40955297-40955319 AAAGATCTACCTATGACCTCAGG + Intergenic
1179650606 21:42806033-42806055 AAAGATCCACCTACGACCTCAGG - Intergenic
1180560612 22:16611824-16611846 AAAGATCCACCTACGACCTCAGG + Intergenic
1182113654 22:27742511-27742533 AAACATCCACCTACGACCTCAGG + Intergenic
1182731985 22:32503264-32503286 AAAGATGCACCTACGACCTCAGG + Intergenic
1182998374 22:34835100-34835122 AAAGATCCACCTACGACCTCAGG + Intergenic
1183818316 22:40322686-40322708 CAAGCTCCACCCAAGACCTCTGG - Intronic
949162388 3:895901-895923 AAAGATCCACCTACGACCTCAGG - Intergenic
949670851 3:6398119-6398141 AAAGATCCACCTACGACCTCAGG + Intergenic
949827142 3:8177520-8177542 AAAGATTCACCTACCACCTCAGG + Intergenic
950926189 3:16744759-16744781 AAAGATCCACCTACGACCTCAGG + Intergenic
951299101 3:20972719-20972741 AAAGATCCACCAACGACCTCAGG - Intergenic
951763044 3:26165373-26165395 AAAGATCCACCTACGACCTCAGG - Intergenic
951889263 3:27553276-27553298 AGAGATCCACCTACGACCTTCGG - Intergenic
951894631 3:27599507-27599529 GGAGATCCACCTACAACCTCAGG + Intergenic
952296587 3:32068002-32068024 AGAGATCCACCTACAACCTCCGG + Intronic
952343800 3:32466409-32466431 AAAGATCCACCTATGACCTCAGG - Intronic
952663748 3:35879566-35879588 AAAGGTCCACCTATGACCTCAGG - Intergenic
952791744 3:37205915-37205937 AGAGATCCACCTACGACCTTGGG + Intergenic
953077446 3:39583108-39583130 AAAGATCCACCTATGACCTCAGG - Intergenic
953176876 3:40561375-40561397 AAATGTCCACCTACGACCTCAGG + Intronic
953361168 3:42298089-42298111 AAAAATCCACATATAACTTCTGG + Intergenic
953599664 3:44349928-44349950 AAAGATCCACCTACGACCTCGGG - Intronic
953599834 3:44351262-44351284 AAAGATCCACCTATGACCTTGGG - Intronic
953826003 3:46251507-46251529 AAAGATCCACCTACGACCTCAGG - Intronic
953841423 3:46392868-46392890 GAAGATCCACCTACGACCTCAGG - Intergenic
954969551 3:54639652-54639674 AAAGATCCACCTACGACCTCAGG - Intronic
955253114 3:57304341-57304363 AAAGATCCACCTATGACCTCGGG + Intronic
956549223 3:70439904-70439926 AAAGATCCACCTACAACCTCTGG - Intergenic
956708951 3:72023611-72023633 AAAGATCCACCTACAACCTCAGG + Intergenic
957060174 3:75475234-75475256 AAAGATCCAGCTACAACCTCAGG - Intergenic
957155328 3:76537583-76537605 GGAGATCCACATATGACCTTGGG - Intronic
957294909 3:78324183-78324205 AAAGATCCACCTACGACCTCAGG + Intergenic
957317612 3:78588367-78588389 AAAGATCCACCTATGACCTCAGG - Intergenic
957394175 3:79618747-79618769 GGAGATCCACCTACGACCTCGGG + Intronic
957735131 3:84192938-84192960 AAAGATCCACCTACGACCTCAGG - Intergenic
957905113 3:86543503-86543525 GAAAATCCACCTATGACATCGGG - Intergenic
958182094 3:90072792-90072814 AAAGATCCAACTACCACCTCAGG - Intergenic
958421723 3:93938516-93938538 GGAGATCCACCCACGACCTCAGG + Intronic
958750734 3:98191541-98191563 AAAGATCCACCTACGACCTCTGG + Intronic
958755255 3:98244405-98244427 GGAGATCCACCTGTGACCTCGGG + Intergenic
959288656 3:104445242-104445264 AAAGACCCACCTATGACCTCGGG - Intergenic
959486046 3:106927882-106927904 AAAGATCCACCTACGACCTAAGG - Intergenic
959543937 3:107571615-107571637 GGAGATCCACCTATGACCTCGGG - Intronic
959972559 3:112422813-112422835 AAAGATCCACCTACGACCTCAGG - Intergenic
960283156 3:115798616-115798638 AAAGATCCACCTATAACCTCAGG - Intergenic
960310457 3:116110700-116110722 AAAGATCCACCTATGACCTCAGG - Intronic
961165040 3:124757656-124757678 AAAGATCCACCTACGACCTCAGG - Intergenic
961563471 3:127747012-127747034 AATGACCCACTTGTGACCTCAGG - Intronic
961713000 3:128841504-128841526 AGAGATCCACCTACAATCTCCGG - Intergenic
961880727 3:130059638-130059660 AAAGATCCGCCTACAACCTCAGG + Intergenic
961893974 3:130152240-130152262 AAAGATCCACCTACGACCTCAGG - Intergenic
962022403 3:131514064-131514086 AAAGATCCACCTACGACCTCAGG - Intergenic
962055938 3:131871771-131871793 ATAAATCCACCTATTACCTCTGG + Intronic
962524252 3:136223189-136223211 AGAGATCCACCTATGACCTCAGG - Intergenic
962660381 3:137596127-137596149 AAAGATCCACCTACAACCTCAGG + Intergenic
963058296 3:141205385-141205407 AAAGATCCACCTACGACCTCGGG + Intergenic
963112071 3:141696204-141696226 AAAGATCCACCTACGACCTCGGG - Intergenic
963319504 3:143798017-143798039 AAAGATCCACCTACGACCTCTGG + Intronic
963402421 3:144816881-144816903 AAATAGCCACCTATGGCTTCAGG - Intergenic
963424940 3:145113549-145113571 AAAGATCCACCTATGACCTCAGG + Intergenic
963456969 3:145556412-145556434 AAAGGTCCGCCTACGACCTCAGG - Intergenic
963468338 3:145710925-145710947 AAAGGTCCACTTACGACCTCAGG + Intergenic
963520218 3:146354305-146354327 AAAGATCCACCTACAACCTCAGG + Intergenic
963521336 3:146362574-146362596 AAAGATGCACCTATGACCTCAGG + Intergenic
963663013 3:148152036-148152058 AAAGATCCACCTACGACCTCAGG + Intergenic
963684019 3:148414773-148414795 AAAGGTCCACCTATGACCTCAGG + Intergenic
963843272 3:150129971-150129993 AACGATCTACATAGGACCTCAGG + Intergenic
963889886 3:150622390-150622412 AAACACCCGCCTATAACCTCAGG - Exonic
964067523 3:152597503-152597525 AAAGATCCACCTACGACCTCAGG + Intergenic
964125784 3:153232010-153232032 AAAGATCCACCTACGACCTCAGG - Intergenic
964300517 3:155280294-155280316 AAAGATCCACCTACGACCTCAGG - Intergenic
964375548 3:156045240-156045262 AATGATCCACTTACAACCTCAGG - Intronic
964983372 3:162712987-162713009 AAAGATCCACCTACGACCTCAGG + Intergenic
965070039 3:163908014-163908036 AAAGATCCACCTACAACCTCAGG + Intergenic
965105506 3:164347340-164347362 AAAGATCCACCTATGACCTCAGG - Intergenic
965262920 3:166505919-166505941 AGAGAGCCACCTATGACTTCTGG - Intergenic
965287004 3:166829197-166829219 AAAGATCCACCTATGACCTCAGG - Intergenic
965334819 3:167422922-167422944 AAAGATCCACCTATGACCTCAGG + Intergenic
965336060 3:167431765-167431787 AAATATCCACCTACGACCTCTGG + Intergenic
965625185 3:170677750-170677772 AAAGATCCACCTACGACCTCAGG - Intronic
965626639 3:170688706-170688728 AAAGATTCACCTATGACCTCAGG - Intronic
965640352 3:170823255-170823277 AAAGATCCACCTACGACCTCAGG - Intronic
965713089 3:171576865-171576887 AAAGATCCACCTACGACCTCAGG + Intergenic
965862237 3:173161026-173161048 AAAGATCCACCTACAACCTCTGG - Intergenic
966066506 3:175828013-175828035 AAAGCTCCACCTACGACCTCAGG + Intergenic
966105374 3:176326812-176326834 AAAGATCCACCTACGACCTCAGG - Intergenic
966278927 3:178207878-178207900 AAAGATCCACCTACGACCTCTGG - Intergenic
966397416 3:179517559-179517581 AAAGATCCACCTATGACCTCTGG + Intergenic
967005599 3:185379506-185379528 AGAGATCCACCTACAACCTCGGG - Intronic
967151833 3:186658249-186658271 AAAGATCCACCTACGATCTCAGG + Intergenic
967212460 3:187180712-187180734 AAAGATCCACCTACGACCTCAGG - Intronic
967244460 3:187471493-187471515 AAAGATCCACCTATGACCTCAGG - Intergenic
967561111 3:190920689-190920711 AAAGATCCACCTACGACCTCAGG + Intergenic
967624974 3:191671827-191671849 AAAGATCCACCTACGACCTCAGG - Intergenic
967644122 3:191900601-191900623 AAAGATCCACCTATGACCTCAGG - Intergenic
967658417 3:192076344-192076366 AAAGATCCACCTATGACCTCAGG - Intergenic
967740193 3:192996135-192996157 AAAGATCCACCTACGACCTCAGG + Intergenic
968413533 4:408814-408836 GGAGATCCATCTATAACCTCAGG - Intergenic
968993106 4:3927926-3927948 AACGATCCACCTACAACCTCAGG + Intergenic
969004067 4:4005311-4005333 AAAGATCCACCTACGACCTCAGG - Intergenic
969654428 4:8488161-8488183 AAAGGTCCACCTATGACCTCAGG - Intronic
969748786 4:9094829-9094851 AAAGATCCACCTATGACCTCAGG + Intergenic
969809841 4:9639406-9639428 AAAGATCCACCTACGACCTCAGG + Intergenic
970029483 4:11658767-11658789 AAAGATCCACCTACAACCTCAGG - Intergenic
970041823 4:11806822-11806844 AAAGATCCACCTACAACCTCAGG + Intergenic
970087295 4:12364345-12364367 AAAGATCCACCTACAACCTCAGG + Intergenic
970256669 4:14175425-14175447 AAAGATCCACCTACAACCTCAGG - Intergenic
970532462 4:16998277-16998299 AAAGATCCACCTACGACCTCAGG + Intergenic
970723620 4:19016839-19016861 AAAGATCCACCTATGACCTTGGG + Intergenic
970854338 4:20635468-20635490 AAAGATCCACCTACGACCTCGGG - Intergenic
971123504 4:23727319-23727341 AAAGATCCACCTATGACCTCAGG - Intergenic
971180278 4:24323794-24323816 AAAGATCCACCTACGACCTCAGG + Intergenic
971199830 4:24501504-24501526 AAAGATCCACCTACGACCTCAGG + Intergenic
971552528 4:27975380-27975402 AAAGATCCACCTACGATCTCTGG + Intergenic
971870794 4:32235927-32235949 AAACATCCAGCAATGACCTGAGG + Intergenic
972071357 4:35021728-35021750 AGAGATCCACCTATGACTTTGGG - Intergenic
973750897 4:54020583-54020605 GGAGATCCACCTACAACCTCGGG + Intronic
974428676 4:61769442-61769464 AAAGATCCACCTACGACCTCAGG - Intronic
975865407 4:78719171-78719193 AAAGATCCACCTACAACCTCAGG - Intergenic
975934177 4:79559159-79559181 AAAGATCCACCTATGACCTCAGG - Intergenic
976382692 4:84418245-84418267 GAAGATCCCCTTAAGACCTCTGG - Intergenic
976558330 4:86475306-86475328 AAAGATCTACCTACGACCTCGGG + Intronic
976696237 4:87922331-87922353 AAAGATCCACCTACGACCTCAGG + Intergenic
976740184 4:88348682-88348704 AAAGATCCACCTGTGACCTCGGG - Intergenic
976884868 4:89969978-89970000 AAAGATCCACCTACGACCTCAGG - Intergenic
977009935 4:91624168-91624190 AAAGATCCACCTAGGACCTCAGG + Intergenic
977013250 4:91660017-91660039 AAAGATCCACCTATGACCTCAGG - Intergenic
977041714 4:92026319-92026341 AAAGATCCACCTACGACCTCAGG + Intergenic
977062886 4:92277097-92277119 AAAGATCCACCTATGACCTCAGG - Intergenic
977075479 4:92444103-92444125 AAAGATCCACCTATGACCTCAGG - Intronic
977217441 4:94298365-94298387 AAAGATCCACCTATGACCTCAGG - Intergenic
977225651 4:94388767-94388789 AAAGATCCACTTAGGACCTCAGG - Intergenic
977446660 4:97139552-97139574 AACGATCCACCTATGACCACTGG - Intergenic
978001408 4:103558942-103558964 AAAGATCCACCTACAACCTCAGG - Intergenic
978031222 4:103941802-103941824 AAAGATCCACCTATGACCTCAGG + Intergenic
978303456 4:107295378-107295400 GGAGATCCACCTACGATCTCGGG - Intergenic
979146329 4:117252587-117252609 AAAGATCCACCTACAACCTCTGG + Intergenic
979379587 4:119994194-119994216 AAAGATCCACCTATGACCTTAGG + Intergenic
979420993 4:120504956-120504978 AATGATGCACCTATGAGGTCAGG - Intergenic
979641072 4:123012850-123012872 AAAGATCCACCTACGACCTCTGG - Intronic
979798545 4:124877129-124877151 GGAGATCCACGTATGACCTCAGG - Intergenic
979850615 4:125566907-125566929 AAAGATCCACCTACGACCTCAGG - Intergenic
979895401 4:126150015-126150037 AAAGATCCACCTACGACCTCAGG - Intergenic
980003633 4:127516653-127516675 AAAGATCCACTTACAACCTCGGG - Intergenic
980112236 4:128646099-128646121 AAAGATCCACCTACAACCTCGGG - Intergenic
980284679 4:130767889-130767911 AAAGATCCACTTACAACCTCAGG + Intergenic
980388624 4:132118669-132118691 AAAGATCCACCTACGACCTCAGG + Intergenic
980491575 4:133534106-133534128 AAAGATCCACCTACGATCTCGGG - Intergenic
980527596 4:134012699-134012721 AAAGATCCACTTACAACCTCAGG + Intergenic
980612078 4:135172588-135172610 AAAGATCCACTTACAACCTCAGG - Intergenic
980714165 4:136610689-136610711 GGAGATCCACCTATGACCTTGGG + Intergenic
980903616 4:138928314-138928336 AAAGATCCACCTACGACCTCAGG + Intergenic
981482939 4:145256469-145256491 GGAGATCCACCTATGACCTCAGG - Intergenic
981524841 4:145699350-145699372 AAAGATCCACCTACGACCTCAGG + Intronic
981539399 4:145833088-145833110 AAAGATCCACCTACGACCTCAGG + Intronic
982084238 4:151817730-151817752 AAAGATCCACCTACGACCTCAGG - Intergenic
982397012 4:154924054-154924076 AAAGATCCACCTATGACCTCGGG - Intergenic
982414490 4:155113686-155113708 AAAGATCCACCTATGACCTCAGG - Intergenic
982497423 4:156108796-156108818 AAAGATCCACCTACGATCTCAGG - Intergenic
982535127 4:156600723-156600745 AAAGATCCACCTACGACCTCAGG + Intergenic
983023581 4:162709662-162709684 AAAGATCCGCCTACAACCTCAGG + Intergenic
983055204 4:163093681-163093703 AAAGATCCACCTACGACCTCAGG + Intergenic
983345309 4:166521177-166521199 AAAGATCCACCTACGACCTCTGG + Intergenic
983360090 4:166716654-166716676 AAAGATCCACCTACGACCTCAGG + Intergenic
983447776 4:167876787-167876809 AAAAGTCCACCTACGACCTCAGG + Intergenic
983452037 4:167923394-167923416 AAAGATCCACCTATGACCTCAGG + Intergenic
983659291 4:170116916-170116938 AAAGATCCACCTATGATCTCAGG + Intergenic
983707422 4:170678123-170678145 AAAGATCCACCTACAACCTCAGG + Intergenic
983884123 4:172961799-172961821 AAAGATCCACCTACAACCTCTGG - Intronic
984099323 4:175466582-175466604 AAAGATCCACCTATGACCACAGG - Intergenic
984165607 4:176299900-176299922 AAAGATCCACCTACGACCTCAGG - Intergenic
984321886 4:178207610-178207632 AAAGATCCACCTACGACCTCAGG + Intergenic
984393888 4:179170019-179170041 AAAGATCCACCTACGACCTCAGG - Intergenic
984436989 4:179721012-179721034 GAAGATCCACCTACGACCTCTGG + Intergenic
984700320 4:182814820-182814842 AAAGACCCACCTACGACCTCAGG + Intergenic
985057628 4:186049174-186049196 AAAAATCCACCTATGACCTCTGG - Intergenic
985079242 4:186247118-186247140 AAAGATCCACCCATGACCTCTGG - Intronic
985390202 4:189484855-189484877 AAAGATCCACCTATGACCTCAGG - Intergenic
985435447 4:189926371-189926393 AAAGATCCACCTATAACCTCAGG + Intergenic
985581975 5:702978-703000 AAAGATCCACCTATGACCTCAGG + Intergenic
986193241 5:5516051-5516073 AAAGATCCACCTACGACCTCAGG + Intergenic
986369217 5:7063234-7063256 AAAGATCCATCTACGACCTCGGG - Intergenic
986388587 5:7264107-7264129 AAAGATCCACCTATGACCTCAGG + Intergenic
986502374 5:8414568-8414590 GATAATCCACCTATGACCTTGGG + Intergenic
986555863 5:9009172-9009194 AAAGATCCACCTATGACCTCAGG - Intergenic
986905494 5:12490399-12490421 AAAGATCCACCTACGACCTCAGG + Intergenic
986919892 5:12667783-12667805 AAAGATCCACCTACGACCTCAGG - Intergenic
987281735 5:16420457-16420479 AAAGATCCACCTATGACCTCAGG + Intergenic
987498421 5:18674052-18674074 AAAGATCCACCTATGACCTCAGG - Intergenic
987755495 5:22095140-22095162 AAAGATCCACCTACGACCTCAGG + Intronic
989615375 5:43332893-43332915 GAACATCCACCTATGACCTCAGG - Intergenic
989659707 5:43786937-43786959 AAAGATCCACCTATGACCTCGGG + Intergenic
989689126 5:44119643-44119665 AAAGATCCACCTACGACCTCGGG - Intergenic
990565357 5:57021972-57021994 GGAGAACCACCTATGACCTCGGG - Intergenic
990728308 5:58780775-58780797 AAACCTCCACCTAAGATCTCAGG - Intronic
992394355 5:76357784-76357806 AAAGATCCACCTACGACCTCAGG + Intergenic
992452513 5:76886492-76886514 AGAGATCCACCTACGACCTCGGG - Intronic
993192367 5:84698747-84698769 AAAGATCCACCTATGACCTCAGG + Intergenic
993836363 5:92824252-92824274 AAAGATCCACCTATGACCTCAGG + Intergenic
994126347 5:96171845-96171867 AAAGATCTACTTACGACCTCTGG - Intergenic
994324601 5:98435027-98435049 GGAGATCCACCTATGACCTTGGG + Intergenic
994376069 5:99016427-99016449 GGAAATCCACCTATGACCTTGGG - Intergenic
994532892 5:100989694-100989716 AAAGATCCACCTATGACCTCAGG - Intergenic
994779347 5:104069930-104069952 AAAGATCCACCTATGACCTCAGG - Intergenic
994901683 5:105780921-105780943 AAATCTCCACCTATGAGCTGTGG - Intergenic
994989301 5:106979117-106979139 AAAGATCCACCTACGACCTCAGG + Intergenic
995599628 5:113781188-113781210 TTAAATCCACCTATGACCTGTGG - Intergenic
995899700 5:117051714-117051736 AAAGATCCACCTACGACCTCAGG - Intergenic
996052895 5:118952169-118952191 AAAGATCCATCTACGACCTCTGG - Intronic
996203566 5:120702860-120702882 AAAGATCCACCTACAACCTCAGG - Intergenic
996345071 5:122478633-122478655 AAACATCCACCTATGGCCTCAGG - Intergenic
996358855 5:122623822-122623844 AAAGATCCACCTACGACCTCAGG - Intergenic
996509615 5:124304249-124304271 AAAGATCCACCTATGACCTCGGG + Intergenic
996527767 5:124497522-124497544 AAAGATCCACCTACGACCTCAGG + Intergenic
996575269 5:124971726-124971748 AAAGATCCACCTACGACCTCGGG - Intergenic
996726160 5:126674865-126674887 GGAGATCCACCTACGACCTTGGG - Intergenic
996745824 5:126845154-126845176 AAAGATCCACCTACGACCTCAGG - Intergenic
997157015 5:131572237-131572259 GGAGATCCACCTATGACCCTGGG + Intronic
997679142 5:135736989-135737011 AGAGATCCACCTACGACCTCGGG - Intergenic
997746129 5:136301912-136301934 AAAGATCCACCTACGACCTCAGG + Intronic
997769974 5:136544867-136544889 AAAGATCCACCAATGACCTCAGG - Intergenic
997772965 5:136570696-136570718 AAAGATCCACCTATGACCTCAGG - Intergenic
997788683 5:136737511-136737533 AAAAATCCACCTATGACCTCGGG + Intergenic
998603152 5:143605459-143605481 ACAGATGCACATATGACCACAGG + Intergenic
998693943 5:144616390-144616412 AAAGATCCACCTATGACCTCTGG - Intergenic
998852708 5:146365741-146365763 TCAGAGCCATCTATGACCTCAGG + Intergenic
998996660 5:147873977-147873999 AAAGATCCACCTACCATCTCAGG - Intronic
999619153 5:153454866-153454888 AAAGATCCATCTATGACCTCAGG - Intergenic
999828624 5:155298234-155298256 AAAGATCATCCTATTACCTGTGG + Intergenic
1000438288 5:161240454-161240476 AAAGATCCACCTACGACCTCGGG + Intergenic
1000439418 5:161248898-161248920 AAAGATCCACCTATGACCTTGGG + Intergenic
1000519720 5:162280650-162280672 AAAGATCCACCTACGACCTCAGG - Intergenic
1000885585 5:166744150-166744172 AAAGATCCACCTACGACCTCAGG - Intergenic
1000935954 5:167303170-167303192 AAAGATCTACCTACGACCTCAGG - Intronic
1001238593 5:170050464-170050486 AAAGACCCACCTTAGAGCTCAGG + Intronic
1001331785 5:170767355-170767377 AAAGATCCACCTATGACCTCAGG - Intronic
1001354743 5:171008318-171008340 AGAGATCCACCTATGACCTCGGG - Intronic
1001460671 5:171910501-171910523 AAATATCCACCTAGGTCCTTGGG + Intronic
1002611270 5:180419972-180419994 AAAGATCCACCTATGACCTCAGG - Intergenic
1003430487 6:6033086-6033108 AAAGATCCACCTACAACCTCAGG - Intergenic
1004105907 6:12667659-12667681 AAAGATCCACCTACGACCTCAGG + Intergenic
1004225271 6:13779063-13779085 TTAAATCCACCTATGACCTATGG - Intergenic
1004283851 6:14302277-14302299 AAAGATCCACCTACGACCTCAGG - Intergenic
1004317475 6:14602673-14602695 TCAGAACCACCTATGACCTTTGG - Intergenic
1004345819 6:14848314-14848336 CAAGTTCCAACTATGACTTCAGG - Intergenic
1004508326 6:16264388-16264410 AAAGATCCACCTACGACCTCAGG - Intronic
1004574936 6:16886463-16886485 AAAGATCCACCTACGACCTCAGG + Intergenic
1004768893 6:18759379-18759401 AAAGATCCACCTACGACCTCAGG - Intergenic
1004836739 6:19539514-19539536 AAAGATCCACCTACGACCTCAGG + Intergenic
1005014961 6:21366716-21366738 AAGGATCCACCTACGACCTCAGG - Intergenic
1007084820 6:39135976-39135998 GGAGATCCACCTATGACCTTGGG - Intergenic
1008078871 6:47174158-47174180 AAAGTTCAATGTATGACCTCTGG + Intergenic
1008476257 6:51938767-51938789 AAAGATCCACCTATGACTTCTGG + Intronic
1008850582 6:56016287-56016309 AAAGATCCACCTATGACCTCGGG - Intergenic
1009343325 6:62586459-62586481 AAAGATCCACCTACGACCTCAGG + Intergenic
1009359094 6:62792104-62792126 AAAGATCCACCTATGACCTCTGG + Intergenic
1009378897 6:63005960-63005982 AAAGATCCATCTACGACCTCTGG + Intergenic
1009464122 6:63950670-63950692 AAAGATCCACCTACGACCTCTGG + Intronic
1010587039 6:77665899-77665921 AAAGATCCACCTACGACCTCAGG - Intergenic
1010827202 6:80487608-80487630 AAAGATCCGCCTACGACCTCAGG - Intergenic
1010829915 6:80515292-80515314 AAAGATCCACCTACGACCTCAGG - Intergenic
1010841570 6:80652882-80652904 AAAGATCCACCTACAACCTCGGG - Intergenic
1011368157 6:86603393-86603415 AAAGATCCACCTACGACCTCTGG - Intergenic
1011372643 6:86654276-86654298 AAAGATACACCTATGAGGTCTGG + Intergenic
1012014663 6:93835198-93835220 AAAGATCCACCAACGACCTCAGG - Intergenic
1012066813 6:94559037-94559059 AAAGATCCACATACGACCTCAGG - Intergenic
1012315511 6:97780026-97780048 AAAGATCCACCTACGACCTCAGG + Intergenic
1012674848 6:102102611-102102633 AAAGATCCACCTGCAAACTCAGG + Intergenic
1012689241 6:102293237-102293259 AAAGATCCACCTATGACCTCGGG + Intergenic
1013408199 6:109861067-109861089 AAAGATCCACCTACGACCTCAGG - Intergenic
1013808362 6:114017617-114017639 AGAGATCCACCTATGACTTCGGG - Intergenic
1013844023 6:114427746-114427768 AAAGATCCACCTATGACCTTAGG - Intergenic
1013891387 6:115032322-115032344 AAAGATCCACCTACGACCTCAGG + Intergenic
1014115575 6:117664677-117664699 AGAGATCCACCTACGACCTCAGG - Intergenic
1014190054 6:118485448-118485470 TAGGATCTACTTATGACCTCTGG + Intronic
1014360476 6:120467582-120467604 AAAGATCCACCTACAACCTCAGG - Intergenic
1014395705 6:120925313-120925335 AAAGATCCACATATGACCTCAGG + Intergenic
1014455196 6:121625752-121625774 AAAGATCCACCTACGACCTCAGG - Intergenic
1014535121 6:122605629-122605651 AAGGAACCACATATGTCCTCTGG + Intronic
1014555536 6:122840288-122840310 AAAGATCCACCTACGACCTCAGG + Intergenic
1014611831 6:123557341-123557363 AAAGATCCACCTGCAACCTCTGG + Intronic
1014614961 6:123587506-123587528 AAAGATCCACTTACGACCTCAGG - Intronic
1014718316 6:124890917-124890939 AAAGATCCACCTACAACCTCAGG + Intergenic
1014794324 6:125707213-125707235 AAAGATCCACCTACGACCTCAGG - Intergenic
1014891273 6:126849353-126849375 AAAGATCCACTTACAACCTCAGG + Intergenic
1015164914 6:130192789-130192811 AAAGATCCACCTACGACCTCAGG + Intronic
1015266428 6:131295885-131295907 AAAGATCCACCTACGACCTCAGG + Intergenic
1015269354 6:131323825-131323847 AAAGATCCACCTACGACCTCAGG + Intergenic
1015271057 6:131339329-131339351 AAAGATCGCCCTATGACCTCAGG + Intergenic
1015277881 6:131403436-131403458 AAAGATCCACCTACGACCTCAGG + Intergenic
1015323510 6:131902082-131902104 AAAGATCCACCTACAACCTCAGG + Intergenic
1015801688 6:137066609-137066631 AAAGATCCACCTACGACCTCGGG - Intergenic
1016204248 6:141453303-141453325 AAAGGTCCACCTACAACCTCAGG + Intergenic
1016248532 6:142016196-142016218 AAAGATCCACCTATGACCTCAGG + Intergenic
1016518509 6:144923685-144923707 AAAGATCCACCTATGACCTCAGG + Intergenic
1016536039 6:145108358-145108380 AAAGATCCACCTACGACCTCAGG - Intergenic
1016650659 6:146455937-146455959 AAAGATCCATCTATGACCTCAGG - Intergenic
1016852971 6:148640258-148640280 AAAGATCCACCTACGGCCTCAGG + Intergenic
1017269564 6:152490818-152490840 GAAGATCCACCTATGACCTTGGG + Intronic
1017484828 6:154892773-154892795 AAAGCCCCACCTCTGACCTCTGG - Intronic
1017779648 6:157705986-157706008 AAAGATCCACCTACGACCTCAGG - Intronic
1017923185 6:158888656-158888678 AGAGATCCACCTATGACCTCAGG - Intronic
1018077341 6:160229128-160229150 AAAGATCCACCTATGACCTCTGG + Intronic
1018084808 6:160291812-160291834 AAAGATCCACCTGTGACCTCAGG - Intergenic
1018495766 6:164344271-164344293 AAGGATCCACCTATGACCTCAGG - Intergenic
1018521818 6:164657553-164657575 AAAGATCCACCTATGACCTCAGG - Intergenic
1020315749 7:6904279-6904301 AAAGATCCACATACAACCTCAGG + Intergenic
1020324207 7:6961812-6961834 AAAGATCCACCTACGACCTCAGG - Intergenic
1020468956 7:8513748-8513770 AGAGAACCACCTATGTCCTATGG + Intronic
1020533012 7:9358656-9358678 AAAGATCCACCTACGACCTCAGG - Intergenic
1020541399 7:9463664-9463686 AAAGATCTACCTAAGACCTCAGG - Intergenic
1020793962 7:12660294-12660316 AAAGATCCACCTACGACCTCAGG + Intergenic
1021172441 7:17414560-17414582 AAAGATCCACCTACAACCTTGGG + Intergenic
1021393365 7:20121244-20121266 AAAGATCCACATACGACCTTGGG + Intergenic
1021637036 7:22703865-22703887 AAAGATCCACCTACGACCTTGGG + Intergenic
1021660384 7:22913903-22913925 GGAGATCCACCTATGACCTCAGG + Intergenic
1021810365 7:24396776-24396798 AAAGATCCACCTATGACCTCAGG + Intergenic
1021978161 7:26029270-26029292 AAAGATCCACCTATGACCTCAGG - Intergenic
1022372600 7:29785468-29785490 AAAGATCCACCTACGACCTCAGG + Intergenic
1022447180 7:30480026-30480048 GGAGATCCACCTATGACCTCGGG + Intergenic
1022572994 7:31471876-31471898 AAAGATCCACCTACGACCTCAGG - Intergenic
1022584803 7:31598171-31598193 AAGGATACATTTATGACCTCAGG + Intronic
1022708821 7:32833095-32833117 AAAGATCGACCTACGACCTCAGG + Intergenic
1022710318 7:32843000-32843022 AAAGATCCACCTACGACCTCAGG - Intergenic
1022855001 7:34305033-34305055 AAAGATCCACCTACGACCTCAGG - Intergenic
1023475474 7:40573271-40573293 AAAGATCCACAGCTGGCCTCTGG - Intronic
1023699188 7:42875823-42875845 AAAGATCCACCTATGACCTCAGG - Intergenic
1024697297 7:51870409-51870431 AAAGATCCACCTACGACCTCAGG + Intergenic
1024739472 7:52338573-52338595 AAAGATTCACCTACAACCTTGGG - Intergenic
1026112004 7:67465827-67465849 AAGTATCCATCTTTGACCTCAGG - Intergenic
1026201456 7:68218197-68218219 GGAGATCCACCTACGACCTCGGG - Intergenic
1027157518 7:75779386-75779408 AAAGATCCACCTATGACCTCAGG + Intronic
1027157994 7:75782010-75782032 AGTGATCCACCTATGACTTCTGG + Intronic
1027851655 7:83460197-83460219 AAAGATCCACCTACGACCTCAGG + Intronic
1028689894 7:93640423-93640445 AAAGATCCACCTATGACCTCAGG + Intronic
1029499945 7:100922748-100922770 AAAGATCCACCTACGACCTTGGG + Intergenic
1030193205 7:106830145-106830167 GGAGATCCACCTACGACCTCGGG + Intergenic
1030441943 7:109597088-109597110 AAAGATCCACCTACGACCTCAGG - Intergenic
1030446009 7:109647065-109647087 AAAGATCCACCTACGACCTCTGG - Intergenic
1030751796 7:113238739-113238761 AAAGATCCACCTACAACCTCAGG - Intergenic
1031004400 7:116456142-116456164 AAAGATCCACCTATGACCTCAGG + Intronic
1031296390 7:120009708-120009730 AAAGATCCACCTACGACCTCAGG + Intergenic
1031355506 7:120782385-120782407 AAAGATCCACCTACGACCTCGGG - Intergenic
1031399642 7:121315896-121315918 AAAGATCCACCTATGACCTCAGG + Intergenic
1031422739 7:121569169-121569191 AAAGATCCACCTACAACCTCAGG - Intergenic
1031525257 7:122817255-122817277 AAAGATCCACCTACAACCTCAGG + Intronic
1031685585 7:124729633-124729655 AAAGATCCACCTACAACCTCAGG + Intergenic
1031776032 7:125910491-125910513 AAAGATCCACCTACGACCTCAGG + Intergenic
1031777033 7:125918049-125918071 AAAGATCCACCTATGACCTCTGG + Intergenic
1033084485 7:138329761-138329783 AGAGCTCCATCTATGACCTCGGG + Intergenic
1033465320 7:141583944-141583966 AAAGATCCACCTACAACCTCAGG - Intronic
1033625354 7:143105577-143105599 GGAGATCCACCTATGACCTCGGG + Intergenic
1033676254 7:143542408-143542430 AAAGATCCACCTACGACCTCAGG - Intergenic
1033695579 7:143787031-143787053 AAAGATCCACCTACGACCTCAGG + Intergenic
1033909790 7:146248715-146248737 AAAGATCCACGTACGACCTCAGG - Intronic
1034085093 7:148315105-148315127 AAAGATCCACCTACGACCTCTGG - Intronic
1035819558 8:2577366-2577388 AATGCTTCACGTATGACCTCAGG + Intergenic
1035880918 8:3243220-3243242 AAAGATCCACCTACCACCACGGG - Intronic
1036071212 8:5441798-5441820 AAAGACCCACCTATGACCTTAGG - Intergenic
1036281175 8:7402818-7402840 GAAGATCCACCTATGACCTCAGG + Intergenic
1036340291 8:7908754-7908776 GAAGATCCACCTATGACCTCAGG - Intergenic
1036371859 8:8169153-8169175 AAAGATCCACCTATGACTTCAGG + Intergenic
1036472647 8:9064693-9064715 AAAGATCCACCTAGGACCTCAGG - Intronic
1036549393 8:9803417-9803439 GGAGATCCACCTACGACCTCGGG + Intergenic
1036639163 8:10571560-10571582 AAAAGTCCACCTACGACCTCAGG + Intergenic
1036879043 8:12496491-12496513 AAAGATCCACCTATGACTTCAGG - Intergenic
1037490110 8:19389911-19389933 AGAAATCCTCCTATGACATCAGG + Intronic
1037516050 8:19633201-19633223 AAAGATTCACCGACGACCTGGGG - Intronic
1040647789 8:49420236-49420258 AAAGATCCATCTATGACCTCGGG + Intergenic
1041652076 8:60311472-60311494 AAAGATGCACCTGTGACCTCAGG - Intergenic
1042453227 8:68973508-68973530 AAAGTTCCACCTATGACCTCAGG + Intergenic
1042705847 8:71665105-71665127 AAAGGTCCACTTATGACCTTGGG + Intergenic
1042707092 8:71675466-71675488 AAAGATCCACCTATGACCTCAGG + Intergenic
1043325885 8:79050518-79050540 AAAGATTCAACAATGACTTCTGG - Intergenic
1043353932 8:79391152-79391174 AAAGATCCACCTATGACCTCAGG - Intergenic
1043597680 8:81903471-81903493 GGAGATCCGCCTACGACCTCAGG - Intergenic
1043720640 8:83544228-83544250 GGAGATCCACCTACGACCTCAGG + Intergenic
1043837408 8:85063317-85063339 AAAGATCCACTTACAACCTCAGG + Intergenic
1044148782 8:88747323-88747345 AAACATCCACTTACAACCTCAGG - Intergenic
1044258888 8:90095336-90095358 AAAGATCCACCTACGACCTCAGG - Intronic
1044416780 8:91948504-91948526 AAAGATCCACATACGACCTCAGG + Intergenic
1044531886 8:93316653-93316675 TAAGATCCACAGATGCCCTCGGG + Intergenic
1044921664 8:97175530-97175552 AAAGCTCCACCTACCACCTCAGG + Intergenic
1044924828 8:97201299-97201321 AAAGATCCACCTACGACCTCAGG + Intergenic
1045077924 8:98590523-98590545 AAAGATCCACCTAGGACCTCAGG - Intronic
1045361416 8:101437154-101437176 AAAGACGCACCGATGACTTCAGG - Intergenic
1045644488 8:104286418-104286440 AAAGATCCACCTACGACCTCAGG + Intergenic
1046074664 8:109301571-109301593 GGAGATCCACCTACGACCTCGGG + Intronic
1046293832 8:112196354-112196376 AACGATCCACCTATGACCTCAGG + Intergenic
1046386660 8:113514827-113514849 AAAGATCCACCTATGACCTCAGG - Intergenic
1046439769 8:114242133-114242155 AAAGATGAACCTACGACCTCAGG + Intergenic
1046442898 8:114282225-114282247 AAAGATCCACCTATGACTTCAGG + Intergenic
1046511799 8:115212782-115212804 AAAGATCCACCTATGACCTCAGG + Intergenic
1046558984 8:115815131-115815153 AAAGATCCACCTATGACCTCAGG + Intergenic
1047699051 8:127432226-127432248 AAACATCCACCTACGACCTCAGG + Intergenic
1047829817 8:128617079-128617101 AAGGATCCACCTACGACCTCAGG - Intergenic
1047856092 8:128914947-128914969 AAAGATCCACCTAGGACCTCGGG + Intergenic
1048135187 8:131741230-131741252 AAAGGTCCACCTATGACCTCAGG + Intergenic
1048168737 8:132085452-132085474 AAAGATCCACCTACGACCTCAGG - Exonic
1048585744 8:135772481-135772503 AAAGATCCACCTATGACCTCAGG - Intergenic
1048728672 8:137413383-137413405 AAAGATCCACCTACAACCTCTGG - Intergenic
1048764531 8:137830066-137830088 AAAGATTCACCTACGACCTCAGG - Intergenic
1049184748 8:141244147-141244169 ACAGAACCTCCTGTGACCTCAGG - Intronic
1049809653 8:144559908-144559930 AAACTTCCACGTCTGACCTCAGG - Intronic
1049869112 8:144959488-144959510 AAAGATCCACCTACGACCTCAGG - Intergenic
1049986540 9:956841-956863 GAACAACCACCTATGATCTCTGG - Intronic
1050117325 9:2276184-2276206 AAAGATCCACCTACGACCTCGGG + Intergenic
1050258374 9:3816266-3816288 AAAGATCCACCTACGACCTCAGG - Intergenic
1050473873 9:6020546-6020568 AAAGATCCACTTATGACCTCTGG + Intergenic
1050499334 9:6278713-6278735 AAACACCCGCCTATAACCTCAGG - Intergenic
1050895831 9:10885455-10885477 AAAGATCCACCTATGACCTCGGG + Intergenic
1050913385 9:11102168-11102190 AGAGATCCACCTATGACCTCGGG - Intergenic
1051052346 9:12948904-12948926 AAAGATCCACCTACGACCTCAGG + Intergenic
1051251748 9:15166382-15166404 CTAGATCCACCTATCTCCTCTGG + Exonic
1051376413 9:16407156-16407178 AAAGATCAACATATGGCTTCAGG - Intergenic
1051849593 9:21490946-21490968 AAAGATCCACCTACGACCTCAGG - Intergenic
1051953650 9:22663559-22663581 AAAGATCCACCTATGTCCTCAGG - Intergenic
1052191533 9:25669408-25669430 AAAGATCCACCTACGACCTCGGG + Intergenic
1052653015 9:31326833-31326855 AAAGATCCACCTACGACCTTGGG + Intergenic
1053057678 9:35003783-35003805 AAAGATCCACCTACGACCTCGGG + Intergenic
1053078687 9:35156139-35156161 GGAGATCCACCTAAGACCTCGGG - Intergenic
1053133907 9:35637416-35637438 GGAGATCCACCTACAACCTCGGG + Intronic
1054807739 9:69409807-69409829 AAAGATCCACCTATGCCCTCAGG - Intergenic
1055232744 9:74086111-74086133 AAAGATCCACCTATGACCTCAGG + Intergenic
1055348033 9:75357063-75357085 AAAGATCCACCTATGACCTCTGG - Intergenic
1055626398 9:78181181-78181203 AAAGATCCACCTACAACCTCAGG + Intergenic
1055809743 9:80137820-80137842 AAAGATCCACCTATGACCTCAGG + Intergenic
1056045008 9:82705748-82705770 AAAGATCCACCTACGACCTCAGG - Intergenic
1056060870 9:82884262-82884284 AAAGATCCACCTACAACCTCAGG + Intergenic
1056323522 9:85458852-85458874 AAAGATCCACCTACTACCTCAGG + Intergenic
1056391653 9:86146589-86146611 GGAGATCCACCTACAACCTCGGG + Intergenic
1056437566 9:86588487-86588509 GAAGATCCACCTACGACCTCAGG - Intergenic
1056522100 9:87411225-87411247 AAAGATCCACCTACGACCTCAGG + Intergenic
1056882721 9:90413223-90413245 AAAGATCCACCTACGACCTCAGG + Intergenic
1057234549 9:93348117-93348139 AAAGATCCACCTACTACCTCAGG + Intergenic
1057377695 9:94540376-94540398 AAAGATCCACCTACGACCTCAGG + Intergenic
1057683648 9:97215044-97215066 AAAGATCCACCTACGACCTCGGG + Intergenic
1057812834 9:98270912-98270934 AAAGATCCACCTATGACCTTGGG - Intergenic
1057981706 9:99670310-99670332 AAAGATCCACCTATGACCTCAGG + Intergenic
1058026529 9:100146014-100146036 AAAGATCCACCTACGACCTCGGG - Intronic
1058612132 9:106788759-106788781 AAAGATCCACCTACAACCTCAGG + Intergenic
1059546437 9:115179825-115179847 AAAGGTCCACCTATGACCTCAGG - Intronic
1059574289 9:115473711-115473733 AAAGATCCACCTACGACCTCAGG + Intergenic
1059821204 9:117974052-117974074 AAATAGCCACTTATGTCCTCTGG - Intergenic
1059863769 9:118490847-118490869 AAAGATCCACCTATGACCTCAGG - Intergenic
1060225864 9:121790529-121790551 AAAGATCCACCTACGACCTCAGG + Intergenic
1060318729 9:122535649-122535671 AAAGATCCACCTACGACCTCAGG - Intergenic
1060738196 9:126079916-126079938 AAAGACCCACCTACGACCTCAGG - Intergenic
1061139297 9:128754605-128754627 ACAGGTCCACCTCTGTCCTCAGG + Intronic
1061582792 9:131547699-131547721 AAAGATCCACCTACGACCTCGGG + Intergenic
1185849648 X:3473592-3473614 AGAGATCCACCTATGACCTTGGG - Intergenic
1185858878 X:3559629-3559651 AAAGATCCACCTATGACCTCAGG - Intergenic
1185961010 X:4545772-4545794 AAAGATCCACCTACGACCTCAGG - Intergenic
1185990777 X:4892143-4892165 AAAGATCCACCTATGACCTCAGG + Intergenic
1186305344 X:8250841-8250863 AAATATCCAACTATGACCAGAGG + Intergenic
1186783779 X:12940355-12940377 AAAGATGCACCTACGACCTCAGG + Intergenic
1187086825 X:16049915-16049937 AAAGATCCACCTACGGCCTCAGG - Intergenic
1187100188 X:16183928-16183950 AAAGATCCACCTATGACCTCAGG - Intergenic
1187104000 X:16221777-16221799 GGAGATCCACCTATGACCTTGGG - Intergenic
1188201231 X:27294450-27294472 ATGGATCCACCTATGACCTCGGG - Intergenic
1188301288 X:28507362-28507384 AAAGATCCACCTATGAACTTGGG - Intergenic
1188333274 X:28897607-28897629 AAAGATCCACCTACGACCTCTGG - Intronic
1188419251 X:29976025-29976047 AAAGATCCACCTACGACCTCAGG + Intergenic
1188430794 X:30104091-30104113 AAAGATCCACCTATGACCTCAGG + Intergenic
1188463667 X:30454300-30454322 AAAGATCCACCTACGACCTCAGG - Intergenic
1188552403 X:31378250-31378272 AAAGATCCACCTACGACCTCTGG + Intronic
1188890830 X:35609879-35609901 AGAGATCCACTTACGACCTCGGG + Intergenic
1189032048 X:37460761-37460783 AAACATCCACCTACAACCTCAGG - Intronic
1191014421 X:55793203-55793225 GGAGATCCACCTATGACCTTGGG - Intergenic
1192253711 X:69436316-69436338 AAAGATCCTCCTTGTACCTCTGG - Intergenic
1192454361 X:71264995-71265017 GGAGATCCACCTATGACCTCAGG + Intergenic
1192705845 X:73528202-73528224 AAAGATCCACCTACGACCACGGG + Intergenic
1192731877 X:73808920-73808942 AAAGATCCACCTATGACCTCTGG - Intergenic
1192764876 X:74130102-74130124 GGAGATCCACCTACGACCTCAGG - Intergenic
1192936080 X:75859543-75859565 GGAGATCCACCTACGACCTCGGG - Intergenic
1193536825 X:82727271-82727293 AGAGATCCACCTATGACCTCAGG + Intergenic
1193885661 X:86982363-86982385 AAAGATCCACCTACAACCTCAGG + Intergenic
1193941165 X:87682208-87682230 AAAGATCCATCTATGACCTCAGG + Intergenic
1194186551 X:90778606-90778628 AAAGATCCACCTATGACCTCAGG - Intergenic
1194293887 X:92105340-92105362 TAAGATCCACCTAGGACCTCAGG - Intronic
1194308829 X:92278266-92278288 TAAGATCCACCTAGGACCTCAGG - Intronic
1194350986 X:92824959-92824981 AAAGATCCACCTAGGACCTCAGG + Intergenic
1194366810 X:93023447-93023469 AAAGATCCACCTACGACCTCAGG + Intergenic
1194503287 X:94704076-94704098 AAAGATCCACCTACGACCTCAGG - Intergenic
1194660382 X:96624483-96624505 AAAGATCCACCTACGACCTCGGG + Intergenic
1194823075 X:98529522-98529544 AAAGATCCACCTACAACCTCAGG - Intergenic
1194874106 X:99164686-99164708 AAAGATCCACCTACGACCTCGGG - Intergenic
1195017189 X:100791406-100791428 GGAGATCCACCTATGACCTCGGG - Intergenic
1195287985 X:103404060-103404082 AAAGATCCACCTCTGAGGGCAGG + Intergenic
1195291531 X:103434938-103434960 AAAGATCCACCTACGACCTCTGG - Intergenic
1195327121 X:103766831-103766853 AAAGATCCACCTACAACCTCTGG - Intergenic
1195660460 X:107372839-107372861 AAAGAGCCACCCTAGACCTCTGG + Intergenic
1195841173 X:109178868-109178890 AAAGATCCATCTATGACCTTAGG + Intergenic
1195908950 X:109870323-109870345 AAAGATCCACCTACGACCTCAGG - Intergenic
1196072768 X:111544337-111544359 AAAGATCCACCTATGACCTCAGG + Intergenic
1196165214 X:112530931-112530953 AAAGATCCACCTATGACCTCAGG + Intergenic
1196221272 X:113113883-113113905 AAAGATCCATCTATGACCTCGGG - Intergenic
1196299746 X:114040567-114040589 AAAGATCCACCTACGACCTCAGG + Intergenic
1196330511 X:114467200-114467222 AAAGATCCACCTATGACCTCAGG + Intergenic
1196469636 X:116011129-116011151 GAAAATCCACCTATGACGTCAGG + Intergenic
1196525786 X:116726197-116726219 AAAGATCCACCTATGATCTCTGG - Intergenic
1196533829 X:116817675-116817697 AAAGATCCACCTACGACCTCAGG - Intergenic
1196572202 X:117279657-117279679 AAAGATCCACCTACAACCTCAGG + Intergenic
1196584874 X:117418382-117418404 AGAGATCCACCTACGACCTCCGG + Intergenic
1196774149 X:119322941-119322963 AAAGATCCACCTACGACCTCAGG - Intergenic
1197064618 X:122222533-122222555 AAAGATCCAACTATGACCTCAGG + Intergenic
1197352344 X:125394009-125394031 AAAGATCCACCTATGACCTCAGG - Intergenic
1197470664 X:126863588-126863610 AAAGATCCACCTACAACCTGGGG + Intergenic
1197608568 X:128612816-128612838 AAAACTCCACCTAGGACTTCAGG + Intergenic
1197932784 X:131712525-131712547 AAAGATCCACTTACAACCTCAGG + Intergenic
1198598134 X:138259138-138259160 AAAGATCCACCTACGACCTCAGG + Intergenic
1198599690 X:138269531-138269553 AAAGATCCACCTACGACCTCAGG - Intergenic
1198983967 X:142428448-142428470 AAAGATCCACCTATGACCTCAGG - Intergenic
1199377915 X:147134270-147134292 AAAGATCCACCTACAACCTCTGG - Intergenic
1199576164 X:149316111-149316133 AAAGATCCACCTACGACCTCAGG + Intergenic
1200533153 Y:4360682-4360704 AAAGATCCACCTATGACCTCAGG - Intergenic
1200611403 Y:5329881-5329903 TGAGATCCACCTATGACCTCAGG - Intronic
1200659313 Y:5941639-5941661 AAAGATCCACCTAGGACCTCAGG + Intergenic
1200675032 Y:6139703-6139725 AAACATCCACCTACGACCTCAGG + Intergenic
1201061866 Y:10053275-10053297 GAAGATCCACCTACGACCTCGGG - Intergenic
1201234473 Y:11896103-11896125 AAAGATCCACCTACAACCTCTGG - Intergenic
1201307721 Y:12564870-12564892 AAAGATCCACCTACGACCTCTGG - Intergenic
1201473751 Y:14359536-14359558 AAAGATCAACATACAACCTCTGG - Intergenic
1201540892 Y:15103529-15103551 GGAGATCCACCTATGACCTCGGG - Intergenic
1201581098 Y:15512797-15512819 AAAGGTCTACCTATGACCTCAGG + Intergenic
1201725028 Y:17141620-17141642 AAAGATCCACCTATGACCTTGGG - Intergenic
1201936133 Y:19412542-19412564 AAAGGTCCACTTACAACCTCAGG + Intergenic
1202076843 Y:21044646-21044668 AACGATCCACCTATGACCTCAGG - Intergenic