ID: 1093268289

View in Genome Browser
Species Human (GRCh38)
Location 12:17026861-17026883
Sequence CAGAGCAAAGAGCAGGAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093268286_1093268289 4 Left 1093268286 12:17026834-17026856 CCTGAGGTCATAGGTGGATCTTT 0: 158
1: 377
2: 219
3: 116
4: 140
Right 1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093268289 Original CRISPR CAGAGCAAAGAGCAGGAGGA CGG Intergenic
No off target data available for this crispr