ID: 1093273256

View in Genome Browser
Species Human (GRCh38)
Location 12:17092647-17092669
Sequence CTTTTATTCTTATGAACAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093273256_1093273259 -9 Left 1093273256 12:17092647-17092669 CCTTTTGTTCATAAGAATAAAAG No data
Right 1093273259 12:17092661-17092683 GAATAAAAGTTAAAATAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093273256 Original CRISPR CTTTTATTCTTATGAACAAA AGG (reversed) Intergenic
No off target data available for this crispr