ID: 1093276479

View in Genome Browser
Species Human (GRCh38)
Location 12:17134659-17134681
Sequence TGATGGACTAATGCAAATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093276479_1093276481 9 Left 1093276479 12:17134659-17134681 CCTCAATTTGCATTAGTCCATCA No data
Right 1093276481 12:17134691-17134713 AGTAATTTTAATTGAATTTATGG No data
1093276479_1093276482 25 Left 1093276479 12:17134659-17134681 CCTCAATTTGCATTAGTCCATCA No data
Right 1093276482 12:17134707-17134729 TTTATGGATTGCAACTTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093276479 Original CRISPR TGATGGACTAATGCAAATTG AGG (reversed) Intergenic
No off target data available for this crispr