ID: 1093284385

View in Genome Browser
Species Human (GRCh38)
Location 12:17240370-17240392
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093284385_1093284387 -10 Left 1093284385 12:17240370-17240392 CCATCACTCTACCTATATTTGAG No data
Right 1093284387 12:17240383-17240405 TATATTTGAGTTCCCCAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093284385 Original CRISPR CTCAAATATAGGTAGAGTGA TGG (reversed) Intergenic
No off target data available for this crispr